Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Eurypharynx pelecanoides is a species of deep-sea marine eel in the family Eupharyngidae with an extraordinarily large expanding mouth, extremely long jaws containing numerous small teeth, a large distensible abdomen, and a long, tapering compressed tail. The cranium is very small relative to the body. (Nielsen 1989). The black scaleless body, relatively longer jaw, smaller abdomen, smaller gill openings which are closer to the anus than the snout, minute teeth and pectoral fins, and more anterior origin of the dorsal fins distinguish the Pelican Eel from the related saccopharyngid eels (eupharyngids and saccopharyngids are both known as “gulper eels”). Mature males undergo a morphological transformation that makes the head appear notched in dorsal view (Charter 1996). The shape and use of the mouth of E. pelecanoides gave rise to the common name Pelican Eel (this species is also known as Umbrellamouth Gulper).

For most of the 20th century, this was considered to be a rare deep-sea fish, but in recent decades hundreds of specimens have been taken, mainly in the Atlantic Ocean. Specimens have ranged from 90 to 620 mm in length. Complete specimens are rarely found. The long, slender tail, the long jaws ,and the soft buccal and abdominal skin tend to become entangled and torn in nets. Most specimens that have been examined have lost part of the tail, but the preanal length is almost always obtainable and there is a clear linear function between preanal and total lengths. Thus, an approximate total length can be estimated if the preanal length is known. The Pelican Eel has been reported from temperate and tropical regions of all oceans. In the eastern Pacific, it is known from northern California to Peru. In the Atlantic, it is known from off Iceland (65°N) to 48°S. It is believed to occur at depths ranging from 3000 to 500 m. Analysis of the stomach contents of specimens indicates that the diet includes crustaceans, fish, Sargassum seaweed, cephalopods, chaetognaths, pelagic tunicates, scyphozoans, and nemerteans. (Nielsen 1989) Most bony fish are "gape and suck” feeders, sucking food into the mouth by creating a sudden negative pressure in their orobranchial cavity. In these cases, the fish remains more or less stationary while food and surrounding water move into the gape. However, the morphology of the Pelican Eel’s skull and jaws do not permit a sudden expansion of the enormous buccal cavity. Nielsen (1989) describes a hypothesized alternative thrusting method of feeding, analogous to that used by a diving pelican. (Nielsen 1989)

Pelican Eels reproduce by releasing eggs that hatch into planktonic larvae. Data from Pelican Eels that have been collected suggest that females are semelparous, i.e., that they die after reproducing once (Charter 1996). Studies of the mitochondrial genome of the Pelican Eel and related fishes have revealed that eupharyngid and saccopharyngid gulper eels share a large-scale gene rearrangement relative to

other vertebrates (Inoue et al. 2003).

  • Charter, S.R. 1996. Eurypharyngidae: umbrellamouth gulpers. pp. 155-157 in The early stages of fishes in the California Current region (H.G. Moser, ed.). California Cooperative Oceanic Fisheries Investigations Atlas No. 33. Allen Press, Lawrence, Kansas.
  • Inoue, J.G., Miya, M., Tsukamoto, K., and M. Nishida. 2003. Evolution of the deep-sea gulper eel mitochondrial genomes: Large-scale gene rearrangements originated within the eels. Molecular Biology and Evolution 20: 1917-1924.
  • Nielsen, J. G., Bertelsen, E., and A. Jespersen. 1989. The Biology of Eurypharynx pelecanoides. Acta Zoologica 70(3): 187-197.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sara Eckert and Leo Shapiro

Supplier: Sara Eckert

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Eurypharynx pelecanoides

Eurypharynx pelecanoides is a species of deep-sea marine eel with an extraordinarily large expanding mouth, extremely long jaws containing numerous small teeth, a large distensible abdomen, and a long, tapering compressed tail. The cranium is very small relative to the body. (Nielsen 1989). The black scaleless body, relatively longer jaw, smaller abdomen, smaller gill openings which are closer to the anus than the snout, minute teeth and pectoral fins, and more anterior origin of the dorsal fins distinguish the Pelican Eel from the related saccopharyngid eels (eupharyngids and saccopharyngids are both known as “gulper eels”). Mature males undergo a morphological transformation that makes the head appear notched in dorsal view (Charter 1996). The shape and use of the mouth of E. pelecanoides gave rise to the common name Pelican Eel (it is also known as Umbrellamouth Gulper).

For most of the 20th century, this was considered to be a rare deep-sea fish, but in recent decades hundreds of specimens have been taken, mainly in the Atlantic Ocean. Specimens have ranged from 90 to 620 mm in length. Complete specimens are rarely found. The long, slender tail, the long jaws ,and the soft buccal and abdominal skin tend to become entangled and torn in nets. Most specimens that have been examined have lost part of the tail, but the preanal length is almost always obtainable and there is a clear linear function between preanal and total lengths. Thus, an approximate total length can be estimated if the preanal length is known. The Pelican Eel has been reported from temperate and tropical regions of all oceans. In the eastern Pacific, it is known from northern California to Peru. In the Atlantic, it is known from off Iceland (65°N) to 48°S. It is believed to occur at depths ranging from 3000 to 500 m. Analysis of the stomach contents of specimens indicates that the diet includes crustaceans, fish, Sargassum seaweed, cephalopods, chaetognaths, pelagic tunicates, scyphozoans, and nemerteans. (Nielsen 1989) Most bony fish are :gape and suck” feeders, sucking food into the mouth by creating a sudden negative pressure in their orobranchial cavity. In these cases, the fish remains more or less stationary while food and surrounding water move into the gape. However, the morphology of the Pelican Eel’s skull and jaws do not permit a sudden expansion of the enormous buccal cavity. Nielsen (1989) describes a hypothesized alternative thrusting method of feeding, analogous to that used by a diving pelican. (Nielsen 1989)

Pelican Eels reproduce by releasing eggs that hatch into planktonic larvae. Data from Pelican Eels that have been collected suggest that females are semelparous, i.e., that they die after reproducing once (Charter 1996). Studies of the mitochondrial genome of the Pelican Eel and related fishes have revealed that eupharyngid and saccopharyngid gulper eels share a large-scale gene rearrangement relative to

other vertebrates (Inoue et al. 2003).

  • Charter, S.R. (1996) Eurypharyngidae: umbrellamouth gulpers. p. 155-157. In H.G. Moser (ed.) The early stages of fishes in the California Current region. California Cooperative Oceanic Fisheries Investigations Atlas No. 33. Lawrence, KS: Allen Press.
  • Inoue, J.G., Miya, M., Tsukamoto, K., and Nishida, M. 2003. Evolution of the deep-sea gulper eel mitochondrial genomes: Large-scale gene rearrangements originated within the eels. Molecular Biology and Evolution 20: 1917-1924.
  • Nielsen, J. G., Bertelsen, E., & Jespersen, A. (1989). The Biology of Eurypharynx pelecanoides. Acta Zoologica, 70(3), 187-197.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Sara Eckert

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Meso- to abyssopelagic (Ref. 58302) and bathypelagic (Ref. 58426). Adults feed mainly on crustaceans, but also take fishes, cephalopods, and other invertebrates (Ref. 2850, 11041). Oviparous, planktonic eggs hatch into planktonic leptocephalus larvae (Ref. 6719, 35600). Degenerative changes in males and females suggest semelparity (Ref. 35600).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Circumglobal: In tropical to temperate waters. Eastern Pacific: ranges from northern California to Peru (Ref. 35600).
  • Nielsen, J.G. and E. Bertelsen 1990 Eurypharyngidae. p. 206. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 1. (Ref. 4457)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Circumglobal in tropical and temperate seas, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Analspines: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 762 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 27000))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Mouth greatly enlarged by a backward extension of jaws, gape comprising half or more of preanal length; buccal cavity greatly distensible. Tail attenuated and ending in an expanded, luminous caudal organ. Caudal fin absent; scales absent; lateral line without pores, instead with groups of elevated tubules.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Eurypharynx pelecanoides
Catalog Number: USNM 33295
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1883
Locality: Cape May To Nantucket, New Jersey, United States, Atlantic
Depth (m): 2683
Vessel: Albatross
  • Syntype: Gill, T. N. & Ryder, J. A. 1883. Proceedings of the United States National Museum. 6 (382): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Eurypharynx pelecanoides
Catalog Number: USNM 33386
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1883
Locality: Nantucket To Cape Sable, N. S., Massachusetts, United States, Atlantic
Depth (m): 2394
Vessel: Albatross
  • Syntype: Gill, T. N. & Ryder, J. A. 1883. Proceedings of the United States National Museum. 6 (382): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Eurypharynx pelecanoides
Catalog Number: USNM 33294
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1883
Locality: Cape May To Nantucket, New Jersey, United States, Atlantic
Depth (m): 711
Vessel: Albatross
  • Syntype: Gill, T. N. & Ryder, J. A. 1883. Proceedings of the United States National Museum. 6 (382): 271.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Eurypharynx pelecanoides
Catalog Number: USNM 50724
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration; Radiograph
Year Collected: 1899
Locality: Halfway Between Midway Islands and Guam, Pacific
Vessel: Nero
  • Type: Bean, B. A. 1904. Smithsonian Miscellaneous Collections. 45 (1457): 254, fig. 31.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found at depths of 500- 7500 m.
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 500 - 7625 m (Ref. 58426), usually 1200 - 1400 m (Ref. 559)
  • Coad, B.W. and J.D. Reist 2004 Annotated list of the arctic marine fishes of Canada. Can. MS Rep. Fish Aquat. Sci. 2674:iv:+112 p. (Ref. 58426)
  • Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 227 specimens in 1 taxon.
Water temperature and chemistry ranges based on 193 samples.

Environmental ranges
  Depth range (m): 0 - 4000
  Temperature range (°C): 1.433 - 21.427
  Nitrate (umol/L): 0.189 - 44.710
  Salinity (PPS): 33.836 - 36.622
  Oxygen (ml/l): 0.689 - 6.416
  Phosphate (umol/l): 0.034 - 3.216
  Silicate (umol/l): 0.829 - 141.240

Graphical representation

Depth range (m): 0 - 4000

Temperature range (°C): 1.433 - 21.427

Nitrate (umol/L): 0.189 - 44.710

Salinity (PPS): 33.836 - 36.622

Oxygen (ml/l): 0.689 - 6.416

Phosphate (umol/l): 0.034 - 3.216

Silicate (umol/l): 0.829 - 141.240
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 500 - 7500m.
From 500 to 7500 meters.

Habitat: bathypelagic. Feeds mainly on crustaceans, but also takes fishes, cephalopods, and other invertebrates (Ref. 2850; 11041). Oviparous, eggs hatch into leptocephalus larvae (Ref. 6719).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Meso- to abyssopelagic (Ref. 58302) and bathypelagic (Ref. 58426). Feed mainly on crustaceans, but also take fishes, cephalopods, and other invertebrates (Ref. 2850, 11041). Parasite of the species is known to be Pistana eurypharyngis, a parasitic cestode (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on crustaceans, fishes, cephalopods and other invertebrates
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous (Ref. 35600). Degenerative changes in males and females suggest semelparity (Ref. 35600). Egg cells within each of the gonads have the same developmental stage (monocyclic ovaries) suggesting only one spawning during its lifetime or periodic spawning (Ref. 36055).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eurypharynx pelecanoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACAATCACCCGTTGATTCTTTTCTACCAACCACAAAGATATTGGCACCCTATATTTAGTATTTGGTGCCTGAGCCGGCATAGTCGGCACCGCACTAAGCCTATTAATTCGCGCTGAACTTACTCAACCAGGAGCCCTTCTTGGAGATGATCAGATTTATAATGTTATCGTAACAGCCCATGCTTTTGTAATAATTTTCTTTATGGTGATACCAATTATAATCGGAGGATTCGGCAATTGACTAATCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCCCGTATGAACAATATAAGCTTCTGACTTCTCCCCCCCTCATTTCTTCTCCTTTTAGCCTCTTCCGGGGTAGAAGCCGGAGCCGGCACAGGGTGAACCGTTTATCCTCCCCTAGCTGGAAATTTAGCTCATGCCGGAGCATCAGTAGATTTAACAATCTTCTCACTTCATCTTGCAGGAATCTCCTCAATTCTTGGGGCCATTAATTTTATTACGACCATTATTAATATAAAACCCCCAGCCATTTCACAATACCAAACACCCCTTTTTGTTTGATCTGTGTTAGTCACCGCTGTCCTCTTACTCTTATCCCTCCCCGTCCTAGCTGCGGGCATCACAATACTCCTAACTGACCGAAACTTAAACACAACATTCTTTGATCCTGCAGGAGGGGGGGACCCCATCCTTTACCAACACCTATTCTGATTTTTTGGGCACCCAGAAGTTTATATCTTAATTTTACCCGGATTCGGAATAATTTCACACATTATTACCTATTACTCGGGCAAAAAAGAGCCCTTCGGATATATGGGCATAGTTTGAGCCATAATAGCCATTGGCCTATTAGGCTTCATCGTATGAGCCCACCATATATTCACGGTTGGCATAGATGTAGACACCCGTGCCTATTTCACCTCCGCCACCATAATTATTGCTATCCCAACAGGCGTGAAAGTCTTTAGCTGATTAGCCACCTTGCATGGCGGAGCCATTAAATGAGAAACGCCCCTTCTCTGAGCACTTGGTTTCATCTTCCTCTTTACAGTGGGAGGCCTAACAGGAATCGTACTAGCAAATTCCTCAATCGACATTGTACTACATGACACATACTATGTTGTTGCCCACTTCCACTATGTCTTGTCTATAGGAGCAGTATTTGCCATTATAGGAGGCTTCATCCACTGGTTCCCATTATTTACAGGGTACACCCTCCACCAAAAATGAACTAAAGTACACTTTGGTATCATATTTTTAGGTGTTAATTTGACCTTCTTCCCACAACACTTTCTTGGGCTCGCTGGTATGCCACGACGATACTCCGACTACCCAGATGCCTATACCCTATGAAACTTTATCTCATCAATTGGCTCGCTCATCTCACTTACAGCAGTTATTCTGTTCCTATTTATTCTATGAGAAGCATTCGCCGCTAAACGAGAAGTATTAGGAGCAGAACTCACAATAACAAATGTCGAATGAATTAACGGGTGTCCTCCCCCCTATCACACATTTGAAGAACCCGCATATGTTCAGATTCAACTATATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eurypharynx pelecanoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pelican eel

The pelican eel, Eurypharynx pelecanoides, is a deep-sea fish rarely seen by humans, though it is occasionally caught in fishing nets. It is an eel-like fish and the only known member of the genus Eurypharynx and the family Eurypharyngidae. It belongs to the order Saccopharyngiformes, which is closely related to the true eels in Anguilliformes. It is also referred to as the gulper eel, pelican gulper, and umbrella-mouth gulper.[1] The specific epithet pelecanoides refers to the pelican, as the fish's large mouth is reminiscent of that of the bird.

Taxonomy[edit]

The pelican eel has also been described as Gastrostomus pacificus, Macropharynx longicaudatus, Gastrostomus bairdii, Eurypharynx richardi, and Leptocephalus pseudolatissimus; despite this, nobody has been able to demonstrate that more than one species of pelican eel exists.[2]

Description[edit]

Preserved Eurypharyngid

The pelican eel's most notable feature is its large mouth, much larger than its body. The mouth is loosely hinged, and can be opened wide enough to swallow a fish much larger than the eel itself. The pouch-like lower jaw resembles that of a pelican, hence its name. The stomach can stretch and expand to accommodate large meals, although analysis of stomach contents suggests they primarily eat small crustaceans. Despite the great size of the jaws, which occupy about a quarter of the animal's total length, it has only tiny teeth, which would not be consistent with a regular diet of large fish.[3]

The pelican eel uses a whip-like tail for movement. The end of the tail bears a complex organ with numerous tentacles, which glows pink and gives off occasional bright-red flashes. This is presumably a lure to attract prey, although its presence at the far end of the body from the mouth suggests the eel may have to adopt an unusual posture to use it effectively. Pelican eels are also unusual in that the lateral line organ projects from the body, rather than being contained in a narrow groove; this may increase its sensitivity.[3]

The pelican eel grows to about 0.75 m (2.5 ft) in length.[4]

Distribution and habitat[edit]

The pelican eel has been found in the temperate and tropical areas of all oceans.[2] In the north Atlantic, it seems to have a range in depth from 500 to 3,000 m (1,600 to 9,800 ft).[2]

Relationship with humans[edit]

Although once regarded as a purely deep-sea species, since 1970, hundreds of specimens have been caught by fishermen, mostly in the Atlantic Ocean.[2]

Notes[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2015). "Eurypharynx pelecanoides" in FishBase. February 2015 version.
  2. ^ a b c d Nielsen, Jørgen G.; E. Bertelsen; Åse Jespersen (September 1989). "The Biology of Eurypharynx pelecanoides (Pisces, Eurypharyngidae)". Acta Zoologica (Oxford: The Royal Swedish Academy of Sciences) 70 (3): 187–197. doi:10.1111/j.1463-6395.1989.tb01069.x. 
  3. ^ a b McCosker, John E. (1998). Paxton, J.R. & Eschmeyer, W.N., ed. Encyclopedia of Fishes. San Diego: Academic Press. p. 90. ISBN 0-12-547665-5. 
  4. ^ Dianne J. Bray, 2011, Pelican Eel, Eurypharynx pelecanoides, in Fishes of Australia, accessed 7 October 2014, http://www.fishesofaustralia.net.au/home/species/3300

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!