Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Range Description

This species is found in Central, and South America, and the Caribbean. This bat ranges from Peru, Ecuador, Bolivia, Brazil, Guianas, Suriname, and Venezuela to S Sonora and S Tamaulipas (Mexico); Cuba; Jamaica; Puerto Rico; Hispaniola; St. Vincent; Trinidad and Tobago; Margarita Isl (Venezuela); La Gonave Isl (Haiti) (Simmons 2005). It inhabits at lowlands elevation, below 2,200 m (Reid, 1997), but in Venezuela it occur below 500 m (Handley, 1976).

.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Pteronotus parnellii is found from southern Mexico to northern Brazil (Herd 1983).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pteronotus parnellii have tufts of hair sticking out of the sides of their muzzles, hence the name "Parnell's Mustached Bat". Members of this species have long and narrow wings, and their wing aspect ratio is greater than most bats. Both their ears and tragus are narrow and pointed, and they have a furless chin. Their dental formula is i2/2 c1/1 p2/3 m3/3. During their annual molt, which takes place from May to July, their coat turns from a dark brown/blackish color to a brilliant orange/fulvous. The male is usually slightly larger than the female (Estrada 2001).

Range mass: 10 to 20 g.

Range length: 73 to 102 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Pteronotus parnellii mexicanus
Catalog Number: USNM 89277
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): E. Nelson & E. Goldman
Year Collected: 1897
Locality: San Blas, Nayarit, Mexico, North America
Elevation (m): 23
  • Type: Miller, G. S. 1902 Sep 11. Proceedings of the Academy of Natural Sciences, Philadelphia. 54: 401.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It Venezuela the species generally lives in moist areas but tolerates both multistratal evergreen forest and dry deciduous forest (Handley, 1976), in middle elevations and in disturbed areas (Reid, 1997). Roost in caves and mines; it favors large caverns, but smaller roosts, possibly including hollow trees, are also used (Reid, 1997), and may co-occur with other species of mormoopids and phyllostomids (Herd, 1983). Activity begins at sunset (Baterman and Vaughan, 1974), although maximum movement can occur two hours later (Bonaccorso, 1979). Individuals remain active for 5 to 7 hours, then return to the day roost. Some may be active again shortly before dawn. Forest trails are often used as flyways or foraging areas; streams and creeks are seldom used. A medium-sized bat flying fast and straight along a forest trail is most likely to be of this common and widespread species (Whitaker and Findley, 1980). It feeds primarily on moths and beetles; other types of insects and some seeds have also been found in fecal material; insects are found by echolocation, but the echolocation pulse is unique in that the major portion of the call in not frequency modulated (Eisenberg, 1989).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

P. parnellii lives in edge habitats (Estrada 2001). These habitats range from humid to arid (Herd 1983). They also live in moist areas in forest (Gray 1843). They range in elevation from coastal lowland areas to 3000 m.

Range elevation: 0 to 3000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

P. parnellii eats moths, butterflies, and beetles (Herd 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Pteronotus parnelli is prey of:
Epicrates inornatus
Diptera
Secernentia nematodes

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pteronotus parnelli preys on:
Coleoptera
Lepidoptera

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

P. parnellii is born immobile with closed eyes and naked skin, but with good hearing (Herd 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The females are monestrous. The timing of pregnancy varies from region to region, but pregnancies generally take place from January to July (Gray, 1843). Males and females roost together only around the time of mating (Gray, 1843; Herd, 1983).

Average number of offspring: 1.

Average weaning age: 2-3 months.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Pteronotus parnellii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 363
Specimens with Barcodes: 556
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pteronotus parnellii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 488 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NCCCTATATTTATTATTCGGCGCCTGAGCAGGAATAGTAGGCACCGCCCTCAGCCTCCTAATCCGCGCAGAACTGGGACAACCTGGAGCCCTACTAGGCGATGACCAGATCTATAATGTTGTGGTTACAGCCCATGCCTTTGTGATAATTTTCTTTATAGTTATGCCAATCATAATTGGAGGCTTTGGTAATTGACTAGTGCCTCTAATAATTGGTGCTCCTGATATAGCATTCCCACGAATAAACAACATGAGTTTTTGACTTCTACCACCATCTTTTCTTCTCTTACTAGCCTCCTCAATAGTTGAAGCCGGGGCAGGTACCGGCTGAACTGTCTACCCCCCACTGGCGGGGAACTTGGCCCATGCTGGAGCTTCTGTTGACCTAACCATTTTCTCTCTACATCTAGCAGGAGTATCCTCAATTTTAGGTGCTATTAATTTCATTACCACAATCATTAACATAAAACCCCCAGCCCTGTCCCAATATCAGACACCTTTATTTGTTTGATCAGTATTAATTACAGCTGTCCTACTATTACTCTCCCTTCCCGTCTTAGCAGCTGGCATCACTATACTACTAACGGATCGTAACCTAAACACCACATTCTTTGACCCTGCCGGTGGAGGAGACCCAATTCTATATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Miller, B., Reid, F., Arroyo-Cabrales, J., Cuarón, A.D. & de Grammont, P.C.

Reviewer/s
Medellín, R. (Chiroptera Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, occurrence in a number of protected areas, tolerance to some degree of habitat modification, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Common to abundant in all types of lowland forest (Reid, 1997); rare in Ecuador.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in a number of protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

P. parnellii may carry rabies, Histoplasma, Scopulariopsis, mites, or bat flies, which are hazardous to humans (Herd 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This species feeds on insects that are sometimes injurious to humans. It has also served as a model in the study of echolocation.

Positive Impacts: research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Parnell's mustached bat

Parnell's mustached bat (Pteronotus parnellii) is an insectivorous bat native to North, Central and South America. This bat species ranges from southern Sonora, Mexico south to Brazil. Historically, it had a wider range as fossil specimens have been collected on the island of New Providence, Bahamas. It's a large bat with a forearm length of about 60 millimeters. The ears are short and pointed, and they have no noseleafs, but the lips are wrinkled up and modified into a funnel shape.

ChilonycterisOsburniFord.jpg

These bats live mainly in moist areas, although they can also be found in dry deciduous forests. They roost in caves and tunnels, and sometimes live together with other bat species. The females breed once a year. It was previously thought to be the only bat in the New World to perform Doppler-shift compensation behavior.[3]

References[edit]

  1. ^ "Pteronotus parnellii". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 1996. Retrieved 9 June 2008. 
  2. ^ Pteronotus (Phyllodia) parnellii. Mammal Species of the World. Bucknell.edu. Retrieved 29 December 2012.
  3. ^ Smotherman, M. & Guillén-Servent, A., Michael; Guillén-Servent, Antonio (2008). "Doppler-shift compensation behavior by Wagner's mustached bat, Pteronotus personatus". J. Acoust. Soc. Am. 123 (6, number 123): 4331–4339. doi:10.1121/1.2912436. 
  • John F. Eisemberg and Kent H. Redford, 2000. Mammals of the Neotropics: Ecuador, Bolivia and Brazil.
  • Don E. Wilson, 2003. The Smithsonian book of North American mammals.
  • Buden, Donald W. (1986). "Distribution of Mammals of the Bahamas". Florida Field Naturalist 14 (3): 53–84. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!