Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Summary

"
Habit

Colonial

Niche

Crevices, tree holes, hollows, leaf stems, under leaves

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This widespread species is found through much of South Asia, southern China and mainland Southeast Asia. In South Asia, it is presently known from Afghanistan (Nangarhar and Laghman provinces), Bangladesh (Sylhet division), India (Andhra Pradesh, Assam, Arunachal Pradesh, Bihar, Gujarat, Haryana, Karnataka, Kerala, Jharkhand, Madhya Pradesh, Maharashtra, Manipur, Meghalaya, Orissa, Nagaland, Punjab, Rajasthan, Tamil Nadu, Uttarakhand, Uttar Pradesh and West Bengal), Nepal (Central, Far Western and Mid Western Nepal), Pakistan (North West Frontier Province and Punjab) and Sri Lanka (Central, North Central, Northern, North Western, Sabargamuwa, Southern, Uva and Western Provinces) (Khan 2001; Das 2003; Molur et al. 2002; Srinivasulu and Srinivasulu 2005; Vanitharani 2006; Korad et al. 2007). It has been recorded from sea level to an elevation of 1,500 m asl (Molur et al. 2002). It ranges across southern China, including Hainan island (Simth and Xie 2008). In Southeast Asia, the species ranges through Myanmar, northern Thailand, Lao PDR, Viet Nam and northern Cambodia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"
Global distribution

Afganistan, Bangladesh, China, India, Nepal, Myanmar, Sri Lanka, Vietnam

Known presence in Protected Areas

None

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Colonial
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in a variety of habitat types, including urban areas (G. Csorba and P. Bates pers. comm.). It roosts in crevices and cracks in old buildings, among the leaves and crowns of palms, in hollows of trees and among leaves of banana either singly or in colonies of up to 50 individuals. It emerges late from the roosting site and is a low flyer and flies at a steady speed. One or two young ones are born after a gestation period of 115 days (Bates and Harrison 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"
Niche

Crevices, tree holes, hollows, leaf stems, under leaves

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scotophilus heathii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTATTATTTGGTGCCTGGGCAGGAATAGTAGGAACCGCACTAAGCCTACTTATTCGTACTGAACTTGGTCAGCCTGGTGCCTTAATGGGGGACGACCAGATCTATAATGTAGTTGTAACCGCCCATGCTTTCGTAATAATCTTTTTTATAGTTATACCTATTATAATTGGTGGCTTCGGCAATTGATTAGTACCCCTAATAATTGGTGCCCCTGATATAGCTTTCCCACGAATAAATAACATGAGCTTCTGACTGCTCCCACCATCTTTCCTCCTACTCTTAGCCTCCTCTATAGTCGAAGCAGGCGCCGGTACCGGGTGAACTGTATACCCCCCCTTAGCGGGTAACCTAGCTCATGCAGGGGCCTCTGTAGATTTAACTATTTTTTCCCTACATCTGGCAGGTGTTTCTTCCATCTTAGGGGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCAGCTCTCTCTCAATATCAGACGCCTCTCTTCGTCTGATCTGTTATAATCACTGCAGTTCTCCTTCTCCTATCTCTCCCAGTCCTTGCTGCCGGCATCACAATACTCTTAACGGATCGAAACCTTAACACAACTTTTTTTGACCCTGCAGGAGGGGGAGATCCAATTTTATATCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scotophilus heathii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bates, P., Csorba, G., Molur, S. & Srinivasulu, C.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Cox, N. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, it occurs in a number of protected areas, has a tolerance of a degree of habitat modification, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is widespread in distribution and common in occurrence.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not known
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this widespread species. It might be locally threatened in some areas because of disturbance of roosting sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat loss
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Southeast Asia, it has been recorded from some protected areas. In South Asia, there are no direct conservation measures in place for this species and it has not been recorded from any protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Risk Statement

"
Habitat status

Habitat loss

Data quality

Literature, field studies; Observed, inferred.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater Asiatic yellow bat

The greater Asiatic yellow bat (Scotophilus heathii) is a species of vesper bat.[2] It is found in Afghanistan, Cambodia, China, India, Indonesia, Pakistan, the Philippines, Sri Lanka, and Vietnam.

Like many bats, females have delayed ovulation, with the ability to store sperm. This makes them particularly of interest to biologists.[citation needed] Studies have shown that seasonal changes in hormones allow them to deposit fat before the onset of winter.[3]

It is named after Josiah Marshall Heath, who presented the type specimen to the Zoological Society of London.[4]

Description[edit]

Head and body length is 8-9cm. Forearms 6-7cm. Wingspan 40cm. Weight 48-52g.

Adults are yellowish bronze brown above and bright yellow to reddish below. Wing membrane is blackish brown. Short and dense fur except on neck. Muzzle is blunt, naked, and dark. Tragus is crescent-shaped and separated from the posterior margin of the pinna by a conspicuous notch. Long tailed. Young are dark grayish brown.

Culture[edit]

Known as මහ කහ වවුලා (meaning "greater yellow bat") in Sinhala.

Notes[edit]

  1. ^ Bates, P., Csorba, G., Molur, S. & Srinivasulu, C. (2008). "Scotophilus heathii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2014-01-24. 
  2. ^ Simmons, N. B. (2005). "Order Chiroptera". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 466. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Srivastava, R. K.; Krishna, A. (2008-01-17). "Seasonal adiposity, correlative changes in metabolic factors and unique reproductive activity in a vespertilionid bat, Scotophilus heathi". Journal of Experimental Zoology Part A: Ecological Genetics and Physiology 309A (2): 94–110. doi:10.1002/jez.440. PMID 18203145.  edit
  4. ^ Beolens, Bo; Watkins, Michael; Grayson, Michael (2009). The Eponym Dictionary of Mammals. Maryland: Johns Hopkins University Press. p. 182. ISBN 978-0-8018-9304-9. 

References[edit]



Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!