Overview

Comprehensive Description

Biology

Found near the edge of the continental and insular shelves and uppermost slopes (Ref. 244). Rare in shallow waters (Ref. 9997), bottom associated near shelf breaks and drop-offs; young may occur at 25 m (Ref. 58302). Feeds on bony fishes, other sharks, stingrays, and cuttlefish (Ref. 244). Viviparous (Ref. 50449). Utilized for fishmeal, liver oil, and shagreen (Ref. 9997). Minimum depth reported taken from Ref. 244.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol)
 
Carcharhinus altimus (Springer, 1950)


Bignose shark


Heavy body; snout long, broad, and slightly pointed, its length in front of the mouth 7.5-10.0% of TL; distance from nostrils to mouth < 2.4x mouth width; flaps on front of nostrils large and triangular; upper teeth are long, serrated, slightly oblique triangles, those on sides near front very high, lower teeth with narrow points; prominent ridge present on back between dorsal fins; 1st  dorsal fin high, its origin between end of the pectoral base and halfway along inner pectoral margin; height of first dorsal 8.3-11.9% of TL; apex of first dorsal bluntly pointed; origin of second dorsal fin about above origin of anal fin; pectoral fin long, relatively straight.


Grey, becoming whitish below; distal ends of all fins except pelvics dusky, with pigment on tips of pectorals darker on underside of fins.


Reaches ~ 300 cm; size at birth 65-80 cm.

Habitat: offshore, bottom living, juveniles shallow water.

Depth: 25-500 m, usually below 90 m.

Circumglobal distribution in temperate and tropical seas; Baja and the Gulf of California to central Mexico, Costa Rica to Peru, the Galapagos and Revillagigedos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of Mexico, Israeli part of the Mediterranean Sea - Eastern Basin, Madagascar, Mediterranean Sea, Mozambique, North West Atlantic, Red Sea, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal, with patchy records in tropical and warm seas (Ref. 9997). Western Atlantic: Florida, USA to Venezuela. Eastern Atlantic: Senegal to Ghana, including the Mediterranean. Western Indian Ocean: Red Sea, Mozambique (Ref. 6871), South Africa, Madagascar, and India. Western Pacific: China, Taiwan, and Australia (Ref. 9997). Central Pacific: Hawaii. Eastern Pacific: Gulf of California and southern Mexico, Colombia, and Ecuador.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is circumglobal, but patchily recorded in tropical and warm seas (Compagno in prep, White et al. 2006).

Western central and southwest Atlantic: reported from Florida, Bahamas, Cuba, Nicaragua, Costa Rica, Venezuela, Brazil (Compagno in prep.). Eastern central Atlantic: Senegal, Gambia, Sierra Leone, Ivory Coast and Ghana, and also in the Mediterranean Sea (Golani 2002, Compagno in prep). Indian Ocean: South Africa, Madagascar, India, Maldives, Red Sea and possibly also Sri Lanka (Compagno in prep.). Northwest and western central Pacific: China, Thailand, Indonesia, Philippines (Compagno et al. 2005, Compagno in prep., White et al. 2006). Eastern central and southeast Pacific: Gulf of California, southern Mexico, Colombia, Peru, Ecuador, Revillagigedo Islands (Compagno in prep.). Also occurs off Australia, in the Indian and Pacific Oceans and Hawaii, in the Central Pacific (Compagno in prep.).

A transboundary/migratory species that has been tagged travelling distances between 1,000 and 2,000 miles (Kohler et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Florida to Venezuela
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal, with patchy records in warm seas, including Mediterranean Sea and Red Sea, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 25 (S) - 500 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 300.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 2334)); max. published weight: 167.8 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A heavily-bodied, cylindrical shark with a large, long and broad snout, long nasal flaps and high, triangular, saw-edged upper teeth; interdorsal ridge high and prominent; pectoral and dorsal fins large and straight (Ref. 5578). Grayish with no conspicuous markings, white below (Ref. 5578); inner corners of pectoral fins blackish (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found near the edge of the continental and insular shelves and uppermost slopes. May occur in shallower water. Feeds on bony fishes like lizardfish, croakers, batfish, soles, other sharks (@Squalus@, @Holohalaelurus@), stingrays (@Dasyatis@), and cuttlefish. Viviparous, with 3 to 15 young per litter. Size at birth probably between 70 and 90 cm. Utilized for fishmeal, oil, and shagreen.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Carcharhinus altimus
Catalog Number: USNM 133828
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Collector(s): S. Springer
Year Collected: 1947
Locality: Florida: Key West, 100 Fathoms Off Cosgrove Reef, Monroe County, Florida, United States, Florida Keys, Gulf of Mexico, Atlantic
  • Holotype: Springer, S. 1950. American Museum Novitates. (1451): 9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 25 - 810 m (Ref. 58302), usually 80 - 220 m (Ref. 9253)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs mainly on the edge of continental shelves in deep water (12?430 m), and is more common between 80 and 220 m with very occasional captures in shallow water (Tester 1969). Between North Carolina and Florida, USA, it has a depth range from 12?200 m (Commercial Shark Fishery Observer Program unpubl data). Individuals have been caught at night near the surface over deep water in Hawaii, Maldives, Australia, Brazil and Sri Lanka. Therefore the species is thought to display diurnal vertical migrations (Anderson and Stevens 1996).

Average reproductive age is ~21 years. Males reach maturity at 216 cm total length (TL) and females at 226 cm TL. Maximum size is 282 cm TL and size at birth is 70?90 cm TL (Compagno 1984, Kohler et al. 1995, Jensen et al. 1996). Females give birth to 1?13 pups per litter.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths of 25 - 500m.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 38 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 187.5 - 455
  Temperature range (°C): 10.322 - 17.435
  Nitrate (umol/L): 11.262 - 24.483
  Salinity (PPS): 35.239 - 36.168
  Oxygen (ml/l): 2.048 - 4.030
  Phosphate (umol/l): 0.731 - 1.537
  Silicate (umol/l): 4.452 - 12.627

Graphical representation

Depth range (m): 187.5 - 455

Temperature range (°C): 10.322 - 17.435

Nitrate (umol/L): 11.262 - 24.483

Salinity (PPS): 35.239 - 36.168

Oxygen (ml/l): 2.048 - 4.030

Phosphate (umol/l): 0.731 - 1.537

Silicate (umol/l): 4.452 - 12.627
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 25 - 500m.
From 25 to 500 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Water column only

Habitat: Water column

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449). Gives birth every second year with 1-13 (average 9)pups per litter (Ref.58048). In the Mediterranean, sharks give birth in August and September, however in Madagascar, young are born in September and October (Ref. 244). Size at birth 60-75 cm (Ref. 6871); 70-90 cm TL (Ref.58048). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus altimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTCCTGATTTTGGTGCATGGGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGATCACTTTTAGGGGATGATCAGATTTATAATGTAATTGTAACCGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAATTGATTAGTTCCTTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTCGCCTCTGCTGGAGTAAAAGCTGGAGCAGGTACTGGTTGAACAGTTTATCCCCCATTAGCTAGTAACCTAGCACATGCTGGGCCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTATTTCATCAATTTTAGCTTCAATTAATTTTATTACAACAATTATTAACATAAAACCACCAGCCATTTCACAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGGATTACAATACTACTTACAGATCGTAACCTCAACACTACATTCTTTGACCCTGCAGGTGGAGGAGATCCAATTCTTTATCAACATTTATTTTGATTCTTTGGCCACCCAAAATTTCAAAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus altimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Pillans, R., Amorim, A., Mancini, P., Gonzalez, M. & Anderson, C.

Reviewer/s
Soldo, A., Valenti, S.V., Kyne, P.M. & IUCN SSG Pelagic Shark Red List Workshop participants (Shark Red List Authority)

Contributor/s

Justification
The Bignose Shark (Carcharhinus altimus) is a deepwater, diurnally migrating (12?430 m) whaler shark which probably has a circumglobal distribution on the continental shelf edge in tropical and warm seas, although records are patchy. There are no target fisheries for this species, although it is taken as bycatch in deep set pelagic longlines including widespread tuna longline fisheries, and occasionally in bottom trawls. Reported catches are small, but shark bycatch in longline fisheries is not reported fully throughout the species? range and cannot be used to assess mortality or population trends. It is closely related to the Sandbar Shark (Carcharhinus plumbeus), which it may often be mistaken for (by both fishers and biologists), and which has been heavily depleted by fishing pressure in the northwest Atlantic. Although no specific data are available for Bignose Shark, it is suspected that this species has also been impacted by longline fisheries operating in this region, warranting an assessment of Near Threatened in the northwest Atlantic based on a suspected decline. Fishing pressure is also high in Southeast Asia, where this species is utilized whole. Its presence is also confirmed in the Hong Kong fin trade. The Bignose Shark is taken in bottom trawls in the western Indian Ocean, probably by line or gillnet off India and in nearshore pelagic longlines around the Maldives. Catch rates reported by fishermen in the Maldives have declined significantly in recent years. In Australia this species is not commercially fished, where it is assessed as Least Concern. At present there is insufficient information to assess this species beyond Data Deficient globally. However, given that it may have similarly vulnerable life history characteristics to the related Sandbar Shark, evidence for declines in some regions and high fishing pressure in large parts of its range, its status is of concern and data collection and precautionary adaptive collaborative management should be a priority.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The low tag and recapture rate (5.3%) of Bignose Shark (Carcharhinus altimus) does not necessarily reflect a low abundance of this species, but may be due to this species being undesirable or inaccessible to the main body of fishing and tagging effort in the Atlantic Ocean (Kohler et al. 1998). Soto (2001) notes that it is uncommon in Brazil, but that it is probably distributed offshore along the entire Brazilian coast. The species is reported as rare in the Mediterranean Sea (Serena 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Globally, C. altimus is taken in pelagic longline fisheries in deep water (Anderson and Stevens 1996) and is therefore susceptible to capture in widespread tuna longline fisheries. The species is occasionally caught in bottom trawls.

In the US northwestern Atlantic or Gulf of Mexico waters this species is not targeted. It is rarely caught in the US commercial bottom longline fishery (from New Jersey to Louisiana: 46 individuals recorded by fishery observers monitoring ~4% of the fishery during 1994 to 2003) or the US pelagic longline fishery (east coast of the US, Gulf of Mexico and Caribbean: 41 individuals observed recorded by fishery observers monitoring ~ 5% of the fishery during 1992 to 2000). There is no indication that catch rates for this species are increasing in either of these fisheries. However, this species is often misidentified by fishermen and biologists (J. Musick pers. comm.). It is related to the sandbar shark, which it may often be mistaken for, and which has been heavily depleted by fishing pressure in the Northwest Atlantic. Although no specific data are available for C. altimus, it is suspected that this species has also been impacted by longline fisheries operating in this region. It is possible non-US longline vessels targeting tuna (deeper sets) may catch this species as bycatch, however there are no data available to confirm this. In the Caribbean, this species is apparently taken on deep-set longlines (particularly off Cuba, but also southern Florida), and there it is utilized for fishmeal, oil and shagreen (Compagno in prep.).

In the eastern central and southeast Pacific, this species is taken as bycatch of gillnets, bottom longlines and trawls.

In the southwest Atlantic, off Brazil, C. altimus is taken incidentally by commercial fisheries on the outer continental shelf and continental slope. The species was first identified and recorded from the catches of tuna longliners operating out of Santos (São Paulo State, southern Brazil) by Sadowsky and Amorim (1977). They are seldom caught by this fleet but are retained when caught and sold as "other sharks" (Arfelli and Amorim 1994). The bignose shark is also taken in directed artisanal shark longline fisheries around Venezuelan oceanic islands (Tavares 2005).

It is also taken in bottom trawls in the western Indian Ocean and probably by line or gillnet off India. Taken by nearshore pelagic longline around the Maldives; catch rates reported by fishermen to have declined significantly in recent years (C. Anderson pers. comm. 2007). Whole individuals are consumed and traded at local markets in Thailand and the Philippines (Southeast Asian Fisheries Development Center 2006). In Indonesia this species is caught occasionally by shark longliners and is a utilized bycatch of gillnet fisheries (White et al. 2006). It has been confirmed as present in the shark fin trade through genetic testing of fins collected in Hong Kong (Clarke et al. 2006). This species is not commercially harvested in Australia.

In the Mediterranean this species is known to be important bycatch of the pelagic longline fishery operating from eastern Algerian ports (Fowler et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In US waters, under the Fishery Management Plan for Atlantic tunas, swordfish and sharks (National Marine Fisheries Service 2007), Carhcarhinus altimus, is currently listed as a Prohibited Species.

Collection of data and assessment of catches of this species is required throughout its range. This species is taken on the high seas, outside waters managed by coastal States. This species is listed as a highly migratory species under the 1995 UN Agreement on the Conservation and Management of Straddling Fish Stocks and Highly Migratory Fish Stocks (UNFSA). The Agreement specifically requires coastal States and fishing States to cooperate and adopt measures to ensure the conservation of these listed species. To date, there is little progress in this regard. See http://www.unclos.com for further details. Also of relevance is the FAO International Plan of Action for the Conservation and Management of Sharks (IPOA-Sharks) which specifically recommends that Regional Fisheries Organisations (RFO) carry out regular shark population assessments and that member States cooperate on joint and regional shark management plans. This is of particular importance for sharks such as C. altimus, whose stocks are exploited by more than one State on the high seas. Although steps are being taken by some RFOs, such as ICCAT, to collect species-specific data on pelagic sharks, and to ban the practise of shark finning, to date no RFO has limited shark catches or drafted a ?Shark Plan? as suggested in the IPOA-Shark guidelines.

The 2004 ICCAT shark stock assessment workshop (ICCAT 2005) reported that the current situation on submission of shark statistics indicates that the overall volume of catch reported to ICCAT does not represent the total removals of these sharks and the data are also very limited with respect to the size-, age- and sex- composition of the catch. It is noted that improvements in the ICCAT shark database can only be achieved if the Contracting Parties increase infrastructure investment into monitoring the overall catch composition and disposition of the overall catch of sharks and other by-catch species. Therefore, the workshop group recommended that larger monitoring and research investments directed at sharks in particular, and other by-catch species in general, need to be made by the Parties. Above and beyond this main recommendation, the group identified a number of research activities that could provide for improved advice on the status of these species, if implemented. See ICCAT (2005) for further details. This situation applies to all RFOs and is included here as a standard that needs to apply internationally for fisheries that capture pelagic sharks such as this.

Two RFOs, IATTC and ICCAT, have adopted finning (the removal of fins and discard of carcasses at sea) bans, as have several range states (e.g., USA, EU, Australia, Brazil etc.) and the EU. These bans only affect a limited part of the geographic range of this wide ranging shark at present.

Precautionary adaptive collaborative management of target and bycatch fisheries is needed for this potentially vulnerable shark.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bignose shark

The bignose shark (Carcharhinus altimus) is a species of requiem shark, family Carcharhinidae. Distributed worldwide in tropical and subtropical waters, this migratory shark frequents deep waters around the edges of the continental shelf. It is typically found at depths of 90–430 m (300–1,410 ft), though at night it may move towards the surface or into shallower water. The bignose shark is plain-colored and grows to at least 2.7–2.8 m (8.9–9.2 ft) in length. It has a long, broad snout with prominent nasal skin flaps, and tall, triangular upper teeth. Its pectoral fins are long and almost straight, and there is a ridge on its back between the two dorsal fins.

Hunting close to the sea floor, the bignose shark feeds on bony and cartilaginous fishes, and cephalopods. It is viviparous, meaning the embryos are sustained to term via a placental connection. Females bear litters of three to15 pups after a 10-month gestation period. Despite its size, this shark lives too deep to pose much danger to humans. It is caught incidentally by commercial fisheries in many parts of its range; the meat, fins, skin, liver oil, and offal may be used. The International Union for Conservation of Nature presently lacks enough information to assess the global conservation status of this species. However, the various fishing pressures within its range are cause for concern given its slow reproductive rate, and it may have already declined in the northwestern Atlantic and elsewhere.

Contents

Taxonomy and phylogeny

Shark expert Stewart Springer described the bignose shark as Eulamia altima in a 1950 issue of the scientific journal American Museum Novitates. Later authors have regarded the genus Eulamia as a synonym of Carcharhinus. The specific epithet altimus is derived from the Latin altus ("deep"), and refers to the shark's deepwater habits. The type specimen is an immature female 1.3 m (4.3 ft) long, caught off Cosgrove Reef in the Florida Keys on April 2, 1947. An alternate common name for this species is Knopp's shark, originally used by Florida fishery workers since before the species was described.[3][4]




Carcharhinus altimus



Carcharhinus plumbeus





Carcharhinus falciformis




Carcharhinus perezi




Carcharhinus galapagensis



Carcharhinus obscurus



Carcharhinus longimanus



Prionace glauca






Phylogenetic relationships of the bignose shark, based on allozyme sequences.[5]

Phylogenetic studies published by Jack Garrick in 1982 and Leonard Compagno in 1988, based on morphology, placed the bignose shark in the "obscurus group" of Carcharhinus, centered on the dusky shark (C. obscurus) and the Galapagos shark (C. galapagensis). The group consists of large, triangular-toothed sharks with a ridge between the dorsal fins.[6][7] Gavin Naylor's 1992 study, based on allozyme sequences, upheld and further resolved this "ridge-backed" group. The bignose shark was found to be the sister species of the sandbar shark (C. plumbeus), with the two forming one of the group's two branches.[5]

Distribution and habitat

The bignose shark mainly inhabits deeper water.

Patchy records from around the world indicate the bignose shark probably has a circumglobal distribution in tropical and subtropical waters. In the Atlantic Ocean, it occurs from Delaware Bay to Brazil, in the Mediterranean Sea, and off West Africa. In the Indian Ocean, it is known in South Africa and Madagascar, the Red Sea, India, and the Maldives. In the Pacific Ocean, it has been recorded from China to Australia, around Hawaii, and from the Gulf of California to Ecuador. It is reportedly common off Florida, the Bahamas, and the West Indies, and rare off Brazil and in the Mediterranean.[1][4]

The bignose shark is found near the edge of the continental shelf and over the upper continental slope, generally swimming close to the sea floor at depths of 90–430 m (300–1,410 ft). Young sharks may venture into water as shallow as 25 m (82 ft).[8] Night-time captures of this species from close to the surface suggest it may perform a diel vertical migration, moving from deep water upwards or toward the coast at night.[9] In the northwestern Atlantic, the bignose shark conducts a poorly documented seasonal migration, spending summer off the US East Coast and winter in the Gulf of Mexico and the Caribbean Sea. Individual sharks have been recorded traveling distances between 1,600 and 3,200 km (1,000 and 2,000 mi).[1][4]

Description

Characteristic traits of the bignose shark include its prominent nasal flaps, the tall, triangular shape of its upper teeth, and the relatively anterior position of its first dorsal fin.

Rather heavily built, the bignose shark has a long, broad, and blunt snout with the nostrils preceded by well-developed, triangular flaps of skin. The moderately large, circular eyes are equipped with nictitating membranes (protective third eyelids). The mouth is broadly curved and lacks obvious furrows at the corners. The upper teeth number 14–16 rows on either side and have tall, broad, triangular cusps with serrated edges; they are erect at the jaw center and become increasingly oblique towards the sides. The lower teeth number 14–15 rows on either side and have narrow, erect cusps with extremely fine serrations. The five pairs of gill slits are moderately long.[2][8]

The long and wide pectoral fins have pointed tips and nearly straight margins. The first dorsal fin originates roughly over the rear of the pectoral fin bases; it is fairly tall and falcate (sickle-shaped), with a blunt apex and a long free rear tip. The second dorsal fin is relatively large with a short free rear tip, and is positioned slightly ahead of the anal fin. A high midline ridge is present between the dorsal fins. The caudal peduncle has a crescent-shaped notch at the origin of the upper caudal fin margin. The caudal fin has a large lower lobe and a strong ventral notch near the tip of the upper lobe.[8] The dermal denticles are closely spaced but non-overlapping, such as that the skin shows between them; each is oval with three horizontal ridges leading to marginal teeth.[4] The coloration is gray to bronze above, with a faint pale stripe on the flank, and white below; sometimes there is a green sheen along the gills.[10] The tips of the fins (except for the pelvic fins) are darker; this is most obvious in young sharks. Males and females grow to at least 2.7 m (8.9 ft) and 2.8 m (9.2 ft) long respectively; this species possibly reaches 3 m (9.8 ft) in length.[8][4] The maximum weight on record is 168 kg (370 lb).[11]

Biology and ecology

Dogfishes (pictured: Squalus mitsukurii) are included in the diet of the bignose shark.

The bignose shark feeds mainly on bottom-dwelling bony fishes (including lizardfishes, croakers, flatfishes, and batfishes), cartilaginous fishes (including Squalus dogfishes, Holohalaelurus catsharks, Dasyatis stingrays, and chimaeras), and cephalopods.[8][12] In turn, juveniles may potentially fall prey to larger sharks.[10] Like other requiem sharks, this species is viviparous: when the developing embryos exhaust their supply of yolk, the depleted yolk sac is converted into a placental connection through which the mother delivers nourishment. Females bear litters of three to 15 pups, with seven being typical, following a gestation period of approximately 10 months.[12] A single litter may be sired by two or more males.[13] Birthing has been reported to occur in August and September in the Mediterranean, and in September and October off Madagascar. The newborns measure 70–90 cm (28–35 in) long. Males and females mature sexually at around 2.2 and 2.3 m (7.2 and 7.5 ft) long, respectively.[8] The average age of reproductively active individuals is 21 years.[1]

Human interactions

While large enough to perhaps be dangerous, the bignose shark seldom comes into contact with humans due to its preference for deep water.[12] This species is a bycatch of gillnet, bottom trawl, and deep-set pelagic longline fisheries (particularly those targeting tuna) in many parts of its range. It is regularly taken in Cuban waters and used to produce liver oil, shagreen, and fishmeal. Elsewhere, such as in Southeast Asia, the meat is consumed and the fins shipped to East Asia for shark fin soup. The bignose shark is not used commercially in United States, where it is listed as Prohibited Species under the 2007 Fishery Management Plan for Atlantic tunas, swordfish and sharks, or in Australia.[1]

The International Union for Conservation of Nature has listed the bignose shark as Data Deficient overall, due to inadequate population and fishery monitoring. The species is considered to be of concern, however, given it is slow-reproducing and faces widespread heavy fishing pressure. There is evidence that its numbers have recently declined in the Maldives. Furthermore, most bignose shark bycatch occurs in international waters, where a single stock may be affected by multiple fisheries. It is listed as a "highly migratory species" under the 1995 UN Agreement on the Conservation and Management of Straddling Fish Stocks and Highly Migratory Fish Stocks, but thus far this has not led to significant conservation measures. Regionally, the IUCN has assessed the bignose shark as Near Threatened in the northwestern Atlantic. Though specific data are lacking, it is suspected to have declined there because it is commonly misidentified as the sandbar shark, thus the known decline in sandbar shark numbers resulting from US longline fishing may represent a decline in bignose shark numbers, as well. This species has been assessed as Least Concern in Australian waters, where it faces no significant threats.[1]

References

  1. ^ a b c d e f Pillans, R.; Amorim, A.; Mancini, P.; Gonzalez, M.; Anderson, C. (2008). "Carcharhinus altimus". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/161564. Retrieved 30 June 2011.
  2. ^ a b Compagno, L.J.V.; Dando, M.; Fowler, S. (2005). Sharks of the World. Princeton University Press. pp. 289–290. ISBN 978-0-691-12072-0.
  3. ^ Springer, S. (February 9, 1950). "A revision of North American sharks allied to the genus Carcharhinus". American Museum Novitates (1451): 1–13. http://digitallibrary.amnh.org/dspace/handle/2246/4236.
  4. ^ a b c d e Castro, J.I. (2011). The Sharks of North America. Oxford University Press. pp. 400–402. ISBN 978-0-19-539294-4.
  5. ^ a b Naylor, G.J.P. (1992). "The phylogenetic relationships among requiem and hammerhead sharks: inferring phylogeny when thousands of equally most parsimonious trees result". Cladistics 8: 295–318. doi:10.1111/j.1096-0031.1992.tb00073.x. http://deepblue.lib.umich.edu/bitstream/2027.42/73088/1/j.1096-0031.1992.tb00073.x.pdf.
  6. ^ Garrick, J.A.F. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS Circ. 445: 1–194.
  7. ^ Compagno, L.J.V. (1988). Sharks of the Order Carcharhiniformes. Princeton University Press. pp. 319–320. ISBN 0-691-08453-X.
  8. ^ a b c d e f Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization of the United Nations. pp. 457–458. ISBN 92-5-101384-5.
  9. ^ Anderson, R.C.; Stevens, J.D. (1996). "Review of information on diurnal vertical migration in the bignose shark (Carcharhinus altimus)". Marine and Freshwater Research 47 (4): 605–608. http://www.publish.csiro.au/paper/MF9960605.
  10. ^ a b Bester, C. Biological Profiles: Bignose Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on June 30, 2011.
  11. ^ Froese, Rainer, and Daniel Pauly, eds. (2011). "Carcharhinus altimus" in FishBase. July 2011 version.
  12. ^ a b c Hennemann, R.M. (2001). Sharks & Rays: Elasmobranch Guide of the World (second ed.). IKAN – Unterwasserarchiv. pp. 132. ISBN 3-925919-33-3.
  13. ^ Daly-Engel, T.S.; Grubbs, R.D.; Holland, K.N.; Toonen, R.J.; Bowen, B.W. (2006). "Assessment of multiple paternity in single litters from three species of carcharhinid sharks in Hawaii". Environmental Biology of Fishes 76 (2–4): 419–424. http://cis.arl.arizona.edu/PERT/people/Daly-Engel/Daly-Engel_2006.pdf.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!