Overview

Comprehensive Description

Biology

An inshore and offshore shark found over or adjacent to continental and insular shelves and offshore banks (Ref. 244). Prefers offshore islands, coral reefs and banks (Ref. 244). Benthopelagic (Ref. 58302). Feeds mainly on benthic and midwater fishes (including scombrids), also rays, cephalopods (Ref. 244, 1602), and small sharks and occasionally cephalopods (Ref. 37816). Viviparous (Ref. 50449). Up to 11 young, size 50 to 60 cm, are born after a gestation period of 12 months (Ref. 1602, 37816). Potentially dangerous (Ref. 9997). Presumably taken by fisheries in areas where it occurs (Ref. 9997). Caught irregularly by shark and tuna longline and tuna gillnet fisheries. Utilized for its fins (high value in adults), meat, skin and cartilage (Ref.58048). Probably utilized fresh and dried-salted for human consumption (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: shark (English), tiburón (Espanol)
 
Carcharhinus albimarginatus (Rüppell, 1837)


Silvertip shark


Snout moderately long and broadly rounded, length in front of mouth 6.8-9.2% of TL; upper teeth moderately triangular, sides of bases serrated; lower teeth narrowly triangular, smooth; ridge present on back between dorsal fins; origin of first dorsal fin over or slightly before inner pectoral corner; height of first dorsal 7.1-10.6% of TL; apex of first dorsal bluntly to sharply pointed; origin of second dorsal over or slightly behind origin of anal fin, pectoral fin pointed.

Grey, darker on back and shading to white ventrally; distinctive white tips or margins on first dorsal, tail, and pectoral fins.


Grows to 300 cm; size at birth 55-80 cm.

Habitat: coastal-pelagic, inshore to offshore; common on outer reef slopes.

Depth: 0-800 m, usually below ~ 20 m.

Tropical Indo-Pacific; southern Baja and the Gulf of California to Ecuador, all the offshore islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aldabra, Chagos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Indian Ocean: Red Sea and East Africa, including Madagascar, Seychelles, Aldabra Group, Mauritius and the Chagos Archipelago. Western Pacific: off southern Japan to northern Australia and French Polynesia (Ref. 9997). Eastern Central Pacific: southern Baja California, Mexico to Colombia, including the Cocos, Galapagos and Revillagigedo islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Western Indian Ocean: occurs in the Red Sea, off South Africa, Mozambique, Kenya, Madagascar, Aldabra Islands, Mauritius, Seychelles, Chagos Archipelago (Compagno in prep.).

Western central Pacific: occurs off Indonesia, Taiwan (Province of China), Guam, New Caledonia, Philippines, Palau, Marshall, Solomon and Phoenix Islands, Tahiti, Tuvalu, Papua New Guinea (Compagno in prep). Also Northern Australian waters from Carnarvon (Western Australia) to Bundaberg (Queensland), with the exception of the Gulf of Carpentaria and Arafura Sea (Last and Stevens 1994, MIRC 2007, Jones et al. 1991).

Eastern central Pacific: from Southern Baja California, south to Guatemala and Colombia, including the Revillagigedo and Clipperton Islands, Cocos Island and Galapagos Islands (Compagno in prep).

Possibly also occurs in the western central Atlantic (Mexico, Gulf of Mexico and Caribbean Sea) (Compagno in prep.), although its presence in that region is unconfirmed (Grace 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Panama, north to southern Japan and Ogasawara Islands, south to northern Australia, New Caledonia and Tuamotu Archipelago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 800 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 300.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 2334)); max. published weight: 162.2 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

First dorsal fin and pectoral fins angular, and not expanded; upper teeth triangular; interdorsal ridge present (Ref. 1602, 5578). Dark grey or grey-brown above, white below; all fins with conspicuous white tips and posterior margins (Ref. 9997).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found frequently around reefs, coral atolls, and along shorelines. Feeds on bottom-oriented and pelagic fishes (soles, lanternfish, flyingfish, gempylids, tuna, bonito, wahoo, wrasses, eagle rays and octopi). Viviparous with usually 5 or 6, up to 11 pups per litter. Gestation period is about one year, young are born in summer. Size at birth 55 to 80 cm (Ref. 2334). Considered to be potentially dangerous.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Carcharhinus albimarginatus
Catalog Number: USNM 46850
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Magdalena Bay, Mexico., Baja California, Mexico, Pacific
Vessel: Albatross
  • Paralectotype: Rosenblatt, R. H. & Baldwin, W. J. 1958. California Fish and Game. 44: 151.; Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 543.; Syntype: Rosenblatt, R. H. & Baldwin, W. J. 1958. California Fish and Game. 44: 151.; Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 543.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paralectotype; Syntype for Carcharhinus albimarginatus
Catalog Number: USNM 46847
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Year Collected: 1889
Locality: Socorro Island., Socorro Island, Mexico, Revillagigedo Islands, Pacific
Vessel: Albatross
  • Paralectotype: Rosenblatt, R. H. & Baldwin, W. J. 1958. California Fish and Game. 44: 151.; Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 543.; Syntype: Rosenblatt, R. H. & Baldwin, W. J. 1958. California Fish and Game. 44: 151.; Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 543.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype; Syntype for Carcharhinus albimarginatus
Catalog Number: USNM 46846
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Clarion Island., Clarion Island, Mexico, Revillagigedo Islands, Pacific
Vessel: Albatross
  • Lectotype: Rosenblatt, R. H. & Baldwin, W. J. 1958. California Fish and Game. 44: 151.; Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 543.; Syntype: Rosenblatt, R. H. & Baldwin, W. J. 1958. California Fish and Game. 44: 151.; Gilbert, C. H. 1891 (1892). Proceedings of the United States National Museum. 14 (880): 543.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 800 m (Ref. 6871), usually 20 - ? m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs on the continental shelf, offshore islands, coral reefs and offshore banks, from surface waters to depths of 600?800 m (Compagno et al. 2005). It is also found inside lagoons, near drop offs and offshore (Compagno et al. 2005).

Reproduction is viviparous, with a yolk sac placenta (Compagno et al. 2005, White et al. 2006). Females give birth to 1?11 pups per litter (average six) biennially, after a 12 moth gestation period (Compagno et al. 2005, Last and Stevens 1994, White et al. 2006). Size at birth is reported at 63?68 cm total length (TL) (Compagno et al. 2005) and 73?81 cm TL (White et al. 2006). Young are found in shallow water closer to shore, whereas adults are more wide-ranging (Compagno et al. 2005). This is a large, slow-growing shark, which reaches a maximum size of 300 cm TL (Compagno et al. 2005). Compagno et al. (2005) report that males mature at 160?180 cm TL and females at 160?199 cm TL. White et al. (2006) report that males mature at 190?200 cm TL and females at ~195 cm TL.

This species may not disperse widely between sites, potentially making remote populations vulnerable to depletion (Compagno et al. 2005).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 67 specimens in 1 taxon.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 28 - 102.5
  Temperature range (°C): 24.082 - 27.844
  Nitrate (umol/L): 0.057 - 5.255
  Salinity (PPS): 34.411 - 35.470
  Oxygen (ml/l): 3.591 - 4.734
  Phosphate (umol/l): 0.083 - 0.567
  Silicate (umol/l): 0.777 - 10.063

Graphical representation

Depth range (m): 28 - 102.5

Temperature range (°C): 24.082 - 27.844

Nitrate (umol/L): 0.057 - 5.255

Salinity (PPS): 34.411 - 35.470

Oxygen (ml/l): 3.591 - 4.734

Phosphate (umol/l): 0.083 - 0.567

Silicate (umol/l): 0.777 - 10.063
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 800m.
Recorded at 800 meters.

Habitat: reef-associated. Silvertip shark.  (Ruppell, 1837) Attains 2.75 metres. This is a large and rather slender-bodied shark with a moderately long and rounded snout. The upper half is a coppery-brown colour and the underside is white. All fins have a white tip or white outer edge which is particularly noticeable in the first dorsal, the pectoral, pelvic and caudal fins. Seen underwater these bright white edges are even more noticeable. Juveniles also have these markings. This is an inquisitive and often bold shark of the open ocean, especially around oceanic islands or associated with ships at sea . The silvertip shark appears to be equally at home near the surface or in the depths of the ocean down to at least 600 metres. The natural diet of this shark consists of a wide variety of fish, comprising of both surface species such as flyingfish and tuna, and bottom dwelling fish such as soles and lantern fishes. The viviparous females produce litters of about six pups, although a maximum of 11 has been recorded. While no attacks on humans have yet been attributed to this species, it is, nevertheless potentially dangerous and should be approached with caution. Occurs widely in tropical Indian Ocean and the western and eastern Pacific, but noticeably absent from Australia, central Pacific and Atlantic Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Reef associated (reef + edges-water column & soft bottom), Water column

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

It is common in clear water, particularly on steep slopes (Ref. 54301). An inshore and offshore shark found over or adjacent to continental and insular shelves and offshore banks (Ref. 244). Prefers offshore islands, coral reefs and banks (Ref. 244). Benthopelagic (Ref. 58302). Feeds mainly on benthic and midwater fishes, also rays, cephalopods (Ref. 244, 1602, 37816), and small sharks (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449). With 1 to 11 pups per litter (usually 5 or 6) (Ref. 244). Gestation period is about one year, young are born in summer (Ref. 244). Size at birth 55 to 80 cm (Ref. 2334); 713-81 cm TL (Ref.58048). In southern hemisphere, both breeding and pupping occur in summer (Ref. 37816). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus albimarginatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTCGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCTGAACTTGGGCAACCTGGGTCACTCTTAGGGGATGATCAGATTTACAATGTAATCGTAACCGCTCACGCTTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGTGGTTTTGGAAATTGACTAGTTCCTTTAATAATTGGTGCGCCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTCCTTCTTCTCCTCGCCTCAGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTACCCTCCATTAGCTAGCAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATTCTAGCCTCAATTAATTTTATTACAACTATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTCGTAACCACTATTCTTCTTCTCCTATCACTTCCAGTTCTTGCAGCAGGGATTACAATATTACTTACAGATCGCAACCTTAATACTACATTCTTTGATCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACATTTATTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus albimarginatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Pillans, R., Medina, E. & Dulvy, N.K.

Reviewer/s
Stevens, J.D., Dudley, S., Pollard, D., Valenti, S.V., SSG Pelagic Shark Red List Workshop & Kyne, P.M. (Shark Red List Authority)

Contributor/s

Justification
The Silvertip Shark (Carcharhinus albimarginatus) has a wide but fragmented distribution throughout the tropical Indian and Pacific Oceans (reports in the western central Atlantic are as yet unconfirmed). It is a large, slow-growing whaler shark, which appears to be relatively site-specific, possibly with limited dispersion. This species is subjected to bycatch in high seas fisheries and in artisanal longline, gillnet and trawl fisheries throughout its range, and the number of pelagic sharks landed by fishing fleets in all oceans has become increasingly important in recent years. The meat, teeth and jaws are sold locally and fins, skin and cartilage are exported. Few data are available, however there is evidence to suggest that Indonesian fisheries have extirpated local populations of this species from Scott Reef in northern Australia and declines are suspected elsewhere. This species? site-specificity, fragmented populations and life history characteristics indicate that even remote populations are highly vulnerable to target shark fisheries. This information, combined with actual and potential levels of exploitation throughout its range result in a global assessment of Near Threatened, based on suspected overall population declines approaching 30% (close to meeting the criteria VU A2bd+A4bd). More information is needed on the status of separate populations throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Populations appear to be fragmented with apparently low potential for interchange among them.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species is subjected to bycatch in high seas fisheries and in artisanal longline, gillnet and trawl fisheries throughout its range. The number of pelagic sharks landed by fishing fleets in all oceans has become increasingly important in recent years (Mejuto et al. 2006). However, catch statistics are not available (Holts 1988, Smith 1998) and where they are, they are under-reported. This is one of the nine principle species landed by high-seas longline and net fleets. The majority of these fleets target tunas in all of the world?s oceans and as a result have a large bycatch of pelagic sharks (Fowler et al. 2005). This species was not considered in Clarke et al.?s (2006a) recent analysis of the global shark fin trade, although this species? fins have been identified in the trade (Clarke et al. 2006b). It is a known bycatch of western Pacific tuna fleets (Ward et al. 2004).

Coral reef associated species such as Silvertip Sharks are important in countries such as Eritrea, Sudan, Egypt, Saudi Arabia, Yemen, Maldives and Chagos, where reefs dominate coastal habitats (Anderson and Simpfendorfer 2005). In this region elasmobranchs are most commonly taken as bycatch in non-target fisheries or catch-all artisanal fisheries (Anderson and Simpfendorfer 2005). Finning and discarding of carcasses has been reported, especially in offshore and highseas fisheries targeting tuna (Anderson and Simpfendorfer 2005).

This Silvertip Shark is landed in local markets in Indonesia, Myanmar and the Philippines (SEAFDEC 2006). In the Philippines it is in the top ten most landed species by number (0.73%) and weight (2.6%) with individuals ranging in size from 210?240 cm TL and averaging 23 kg in weight (SEAFDEC 2006). Most sharks were landed by longliners (~65%) and gillnetters (~30%) in Indonesia, Philippines and Vietnam. In Malaysia, Thailand and Cambodia trawlers caught significant numbers of sharks, ~88%, 97% and 40%, respectively. Meat, jaws and teeth were sold in local markets and fins, cartilage, livers and skins entered the export markets (SEAFDEC 2006). It has been recorded in markets in Indonesia in small numbers (W. White, pers. comm. 2003). In a five year survey of Indonesian fish landing sites, only 95 individuals were observed out of a total of more than 21,000 sharks recorded (W. White pers. comm.).

There is evidence from northern Australia that finning can deplete and drive local populations to near extinction. Even remote populations are likely highly vulnerable to target fisheries for meat or fins, particularly given the limited dispersal and localised movement patterns (Stevens 1984). Acoustic and baited camera survey techniques were used to census shark abundance at two northern Australian reefs: Mermaid Reef in Rowley Shoals (a Commonwealth Marine Protected Area closed to all fishing) and Scott Reef (within MOU 1974 Box, where access by Indonesians using traditional artisanal fishing techniques is permitted). Shark abundance was an order of magnitude higher on Mermaid Reef (Meekan and Cappo 2004). Silvertip Sharks, noted to be the main target of shark finning fleets, were common on Mermaid Reef and absent at Scott (Meekan and Cappo 2004). Over-fishing is the most plausible explanation of differences in the composition and abundance of shark assemblages between Mermaid and Scott Reefs. Sharks preferentially targeted by fishermen, such as hammerheads and silvertip whalers were absent from counts at Scott Reef. Furthermore, catches of sharks in the local area (MOU74 Box) declined throughout the early 1990s to the point that Indonesian shark fishing vessels have been relatively uncommon in this area in recent years (Wallner and McLoughlin 1996, Fox and Sen 2002). There has been a large increase in the illegal, unregulated and unreported (IUU) fishing in northern Australia in the last few years (J. Stevens pers. obs.). Several initiatives are underway to identify which species are being taken and in what quantities. Some domestic boats are also suspected to be targeting species for their fins in the Northern Territory.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific measures are in place for this species. Catch levels should be quantified and monitored throughout this species? range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Silvertip shark

The silvertip shark (Carcharhinus albimarginatus) is a large species of requiem shark, family Carcharhinidae, with a fragmented distribution throughout the tropical Indian and Pacific Oceans. This species is often encountered around offshore islands and coral reefs, and has been known to dive to a depth of 800 m (2,600 ft). The silvertip shark resembles a larger, bulkier grey reef shark (C. amblyrhynchos), and can be easily identified by the prominent white margins on its fins. It attains a maximum length of 3 m (10 ft).

An aggressive, powerful apex predator, the silvertip shark feeds on a wide variety of bony fishes, as well as eagle rays, smaller sharks, and cephalopods. This species dominates other requiem sharks of equal size when competing for food, and larger individuals are often heavily scarred from conflicts with others of its species. As with other members of its family, the silvertip shark is viviparous, with females giving birth to one to 11 pups in the summer. Silvertip sharks are regarded as potentially dangerous to humans, as they often approach divers quite closely. This slow-reproducing species is taken by commercial fisheries for its meat, fins, skin, cartilage, and jaws and teeth, which has apparently led to local population declines or extirpations. As a result, the International Union for Conservation of Nature has assessed it as Near Threatened.

Contents

Taxonomy and phylogeny

The silvertip shark was originally described as Carcharias albimarginatus by German naturalist Eduard Rüppell, in the 1837 Fische des Rothen Meeres (Fishes of the Red Sea). The name was later changed to the currently valid Carcharhinus albimarginatus.[2] The specific epithet is derived from the Latin albi meaning "white", and marginatus meaning "to enclose with a border".[3] In 1960, a 103 cm (3.4 ft)-long immature male caught off Ras Muhammad in the Red Sea was designated as the type specimen.[2] Based on similarities in morphology, tooth shape, and vertebral characters, Garrick (1982) proposed the grey reef shark as the closest relative of the silvertip shark.[4] This interpretation was corroborated by Lavery (1992), based on allozyme data.[5]

Distribution and habitat

Silvertip sharks are most often found on or near coral reefs.

The silvertip shark is widely but not continuously distributed in the tropical Indian and Pacific Oceans. In the western Indian Ocean, this species occurs from the Red Sea to South Africa, including Madagascar, the Seychelles, the Aldabra Group, Mauritius, and the Chagos Archipelago. In the western Pacific, it is known from off southern Japan to northern Australia, including Taiwan, the Philippines, Indonesia, New Caledonia, Guam, Palau, the Solomon Islands, the Marshall Islands, the Phoenix Islands, and Tahiti. In the eastern Pacific, it occurs from southern Baja California to Colombia, including the Cocos, Galapagos, and Revillagigedo Islands. Its presence in the Gulf of Mexico and the Caribbean Sea is unconfirmed.[2]

Silvertip sharks are found over continental and insular shelves at a depth of 30–800 m (100–2,600 ft), occupying all levels of the water column. They are most common around isolated islands, coral banks, and reef drop-offs.[2][6] Juveniles frequent coastal shallows or lagoons, while adults occur in deeper water, with little overlap between the two age groups.[3][7]

Description

The silvertip shark can be recognized by its white-edged fins.

The silvertip shark is a robust and streamlined species with a moderately long, broad snout and large, round eyes. The five pairs of gill slits are short. There are 12–14 tooth rows on each side of both jaws, with one or two small teeth at the symphysis (middle of the jaws). The upper teeth are broad with oblique triangular cusps and coarse serrations near the base; the lower teeth have erect cusps with fine serrations. The first dorsal fin is large and triangular, originating above or slightly forward of the free pectoral fin tips. There is a ridge between the first and second dorsal fins. The pectoral fins are proportionately longer than in most requiem sharks and falcate (sickle-like) in shape, with pointed tips.[2][8]

The coloration is blue-gray above with a bronze sheen, and white below. There is a subtle white band along the sides and distinctive white tips and borders on all fins. Silvertip sharks can grow up to 3 m (9.8 ft) long, but typically measure 2.0–2.5 m (6.6–8.2 ft) in length. The maximum reported weight is 162.2 kg (358 lbs).[3] Females are larger than males.[7]

Biology and ecology

A silvertip shark at New Hanover Island, Papua New Guinea - individual sharks usually stay at particular reefs.

Though silvertip sharks are quite mobile, they exhibit fidelity to certain areas and there are reports of territorial behavior. They are usually encountered alone or in pairs.[9][10] Small groups of adult females have been seen in deep water.[7] Individual silvertip sharks behave very aggressively towards one another, and many are heavily scarred. They are also reported to dominate Galapagos sharks (C. galapagensis) and blacktip sharks (C. limbatus) of equal size when competing for food.[2] This shark sometimes forms mixed-species aggregations with grey reef sharks. Rainbow runners (Elagatis bipinnulata) have been observed rubbing against silvertip sharks, using the sharks' rough skin to scrape off parasites.[11] They sometimes follow marine mammals such as bottlenose dolphins (Tursiops sp.) in open water, and are themselves followed by pilot fish (Naucrates ductor).[12]

Like the grey reef shark, silvertip sharks sometimes perform a stereotypical threat display if pursued by divers, warning that it is prepared to attack. The display begins with the shark accelerating away to a distance of 15 m (50 ft), before turning and charging towards the perceived threat. At a distance of two body lengths, the shark brakes, turns broadside, drops its pectoral fins, gapes its jaws, lowers the posterior two-thirds of its body, and "shivers". The last two elements of this display are unique to this species; the "shivering" may serve to emphasize its white fin markings. If the diver persists, the shark may rapidly close in and slash with its upper teeth.[13][14]

Feeding

The diet of the silvertip shark consists primarily of bony fishes, such as grouper, mackerel, tuna, escolars, lanternfish, flyingfish, wrasses, and soles. Eagle rays, smaller sharks, and octopus are occasionally taken.[2] Larger sharks tend to be more sluggish and take more benthic prey.[12] The differently shaped dentition in their upper and lower jaws allows them to tackle large prey, gripping and sawing off chunks of flesh with violent twists and turns.[7] Silvertip sharks have been observed swimming around the periphery of groups of feeding sharks of other species, occasionally dashing in to steal food.[2] This species often approaches ships, as they are attracted to certain artificial, low-frequency sounds.[15]

Life history

Like other requiem sharks, the silvertip shark is viviparous; once the embryos exhaust their supply of yolk, the depleted yolk sac develops into a placental connection through which the mother delivers nourishment. In the Southern Hemisphere, mating and parturition both occur in summer.[15] Courtship involves the male biting the female to hold her for copulation; one female observed had the tip of her first dorsal fin bitten off from such activity.[10] Females bear litters of one to 11 (usually five or six) young after a gestation period of about one year, on a biennial cycle. The newborns have been reported to measure 63–68 cm (25–27 in) and 73–81 cm (29–32 in) long by different authors, and are found in shallower water than adults.[1] The growth rate is highly variable in the wild: Kato and Hernandez (1967) reported juvenile silvertip sharks grow an average of 3.8 cm (1.5 in), or 5.3% of their body length, per year, with some individuals growing as much as 20.8 cm (8.2 in, 30.1% of their body length) per year and others showing negative "growth".[16] Males have been reported to be sexually mature at 1.6–1.8 m (5.2–5.9 ft) or 1.9–2.0 m (6.2–6.6 ft) long, and females at 1.6–2.0 m (5.2–6.6 ft) long.[1]

Human interactions

Silvertip sharks often behave boldly towards divers.

Inquisitive and bold, especially in the presence of food, the silvertip shark is regarded as potentially dangerous to humans. Often, several silvertip sharks will rush up from deep water to inspect divers when they first enter the water, which can be an intimidating experience, as the sharks may approach quite close.[17][18] This species has also been known to circle or pursue divers.[15] In one experiment involving bait, a large silvertip shark tore the leg off a dummy dressed in SCUBA gear, demonstrating that this species is capable of inflicting lethal injuries.[2] As of 2008, the International Shark Attack File listed four provoked attacks attributable to this species, none of them fatal.[19]

The silvertip shark is caught by commercial and artisan fisheries across its range using longlines, gillnets, and trawls, both intentionally and as bycatch. The fins are highly valued for shark fin soup and are sold on the export market, along with the skin and cartilage. The meat is marketed locally, fresh or dried and salted, as are the jaws and teeth.[1][20] Silvertip sharks are known to be taken by fisheries in Indonesia, Myanmar, and the Philippines, as well as by various Indian Ocean nations with coral reef fisheries; it is also an increasingly important catch of pelagic fisheries, where it is often finned at sea. This species is susceptible to overfishing, due to its slow reproductive rate and tendency to stay in a certain area. It is believed to have been extirpated by Indonesian artisan fishers at Scott Reef off northern Australia, and is likely becoming rare in many other parts of its range. As a result, the International Union for Conservation of Nature has assessed the silvertip shark as Near Threatened, and noted it may be approaching the criteria for Vulnerable.[1]

References

  1. ^ a b c d e Pillans, R., E. Medina and N.K. Dulvy, N.K. (2007). Carcharhinus albimarginatus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved January 19, 2010.
  2. ^ a b c d e f g h i Compagno, Leonard J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 455–457. ISBN 92-5-101384-5.
  3. ^ a b c Bester, Cathleen. Biological Profiles: Silvertip Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on February 12, 2009.
  4. ^ Garrick, J.A.F. (1982). Sharks of the genus Carcharhinus. NOAA Technical Report, NMFS CIRC-445.
  5. ^ Lavery, S. (1992). "Electrophoretic analysis of phylogenetic relationships among Australian carcharhinid sharks". Australian Journal of Marine and Freshwater Research 43 (1): 97–108. doi:10.1071/MF9920097.
  6. ^ Randall, J.E. and Hoover, J.P. (1995). Coastal fishes of Oman. University of Hawaii Press. p. 28. ISBN 0-8248-1808-3.
  7. ^ a b c d Ferrari, A. and Ferrari, A. (2002). Sharks. New York: Firefly Books. pp. 158–159. ISBN 1-55209-629-7.
  8. ^ Van der Elst, R. and Borchert, P. (1993). A Guide to the Common Sea Fishes of Southern Africa (third ed.). Struik. p. 34. ISBN 1-86825-394-5.
  9. ^ Stevens, J.D. (1984). "Life-history and ecology of sharks at Aldabra Atoll, Indian Ocean". Proceedings of the Royal Society of London, Series B 222: 79–106. doi:10.1098/rspb.1984.0050.
  10. ^ a b Murch, A. Silvertip Shark. Elasmodiver.com. Retrieved on February 12, 2009.
  11. ^ Bright, M. (2000). The Private Life of Sharks: The Truth Behind the Myth. Stackpole Books. p. 74. ISBN 0-8117-2875-7.
  12. ^ a b Stafford-Deitsch, J. (1999). Red Sea Sharks. Trident Press Ltd. pp. 34, 53, 70. ISBN 1-900724-36-7.
  13. ^ Martin, R.A. (March 2007). "A review of shark agonistic displays: comparison of display features and implications for shark-human interactions". Marine and Freshwater Behavior and Physiology 40 (1): 3–34.
  14. ^ Martin, R.A. Agonistic Display in Grey Reef Shark. ReefQuest Centre for Shark Research. Retrieved on February 12, 2009.
  15. ^ a b c Grove, J.S. and Lavenber, R.J. (1997). The Fishes of the Galápagos Islands. Stanford University Press. pp. 73–76. ISBN 0-8047-2289-7.
  16. ^ Kato, S. and Hernandez Carvallo, A. (1967). "Shark tagging in the eastern Pacific Ocean, 1962–1965". In Gilbert, P.W., Mathewson, R.F. and Rail, D.P.. Sharks, Skates, and Rays. Baltimore: The Johns Hopkins Press. pp. 93–109.
  17. ^ Jackson, J. (2000). Diving With Sharks and Other Adventure Dives. New Holland Publishers. p. 31. ISBN 1-85974-239-4.
  18. ^ Powell, D.C. (2003). A Fascination for Fish: Adventures of an Underwater Pioneer. University of California Press. pp. 138–139. ISBN 0-520-23917-2.
  19. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on May 9, 2009.
  20. ^ Froese, Rainer, and Daniel Pauly, eds. (2009). "Carcharhinus albimarginatus" in FishBase. January 2009 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!