Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found over loose rubble in seaward reefs (Ref. 9710). Forms aggregations to feed on zooplankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is known from Sagami Bay, Japan and south Korea (Cheju Islands), the Philippines, Indonesia and northwestern Australia including the Ashmore-Cartier reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: southern Japan to western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: Sagami Bay, Japan to the Philippines and northern Australia (including Western Australia).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 99 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.9 cm SL (male/unsexed; (Ref. 5278))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs over coral and rubble bottoms in seaward reefs at depths between three and 35 m. This species can form large schools.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 35m.
From 3 to 35 meters.

Habitat: reef-associated. Found over loose rubble in seaward reefs (Ref. 9710). Forms aggregations to feed on zooplankton.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 35 m, usually 5 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 8 - 30
  Temperature range (°C): 26.692 - 28.308
  Nitrate (umol/L): 0.047 - 1.118
  Salinity (PPS): 33.913 - 35.037
  Oxygen (ml/l): 4.448 - 4.734
  Phosphate (umol/l): 0.088 - 0.193
  Silicate (umol/l): 0.983 - 3.307

Graphical representation

Depth range (m): 8 - 30

Temperature range (°C): 26.692 - 28.308

Nitrate (umol/L): 0.047 - 1.118

Salinity (PPS): 33.913 - 35.037

Oxygen (ml/l): 4.448 - 4.734

Phosphate (umol/l): 0.088 - 0.193

Silicate (umol/l): 0.983 - 3.307
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cirrhilabrus sp.

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCTTGAGCCGGAATAGTAGGCACAGCCTTAAGCCTACTAATTCGGGCAGAACTAAGCCAACCAGGGGCACTTCTTGGTGATGATCAGATTTATAATGTTATTGTTACCGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTCGGGAACTGACTTGTTCCCCTAATGCTTGGTGCTCCTGATATGGCATTCCCCCGAATAAATAACATGAGCTTTTGGCTCCTTCCCCCATCCTTCCTTCTTCTCCTGGCTTCTTCTGGTGTAGAAGCAGGGGCCGGCACAGGATGAACTGTTTACCCCCCATTATCTGGCAACCTCGCACACGCAGGTGCATCAGTAGACTTAACCATCTTTTCTCTTCACCTAGCAGGCATTTCCTCCATTTTAGGGGCCATCAACTTTATTACTACTATTATTAATATGAAACCGCCTGCCATCTCCCAATATCAAACACCATTATTCGTTTGAGCCGTACTTATTACTGCTGTCCTCCTTCTCCTATCTCTCCCCGTCTTAGCCGCTGGTATTACCATGCTTTTAACCGACCGGAATCTAAATACCACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cirrhilabrus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L. & Hilomen, V.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is relatively widespread and common, and is targeted for the aquarium trade in many parts of its range. However, taxonomic revision is needed as this species likely represents a species complex. It is listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. In Nonoc Island, Philippines, this species occurs in great abundance when present, 540 individuals were recorded within 300 m2 (V. Hilomen pers. comm. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no known major threats to this species, although it is exploited in the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place. This species range overlaps several marine protected areas within its distribution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!