Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits reef flats and lagoon and seaward reefs to a depth of 40 m or more. Occurs singly or in small to large aggregations, taking shelter in dark crevices, branched coral, under ledges, and among the spines of Diadema setosum. Nocturnal species (Ref. 7300). Feeds on small crustaceans and gastropods, also on small fishes. Generally common (Ref. 9710). Has been reared in captivity (Ref. 35404).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to Mozambique (Ref. 4329) and eastward to the Pitcairn Group, north to southern Japan, south to Lord Howe Island and Rapa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Marshall Islands and Pitcairn Group, north to Ogasawara Islands, south to Western Australia, Queensland (Australia), Lord Howe Island and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 2158))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Nocturnal species (Ref. 7300). Inhabits reef flats and lagoon and seaward reefs to a depth of 40 m or more. Occurs solitarily or in small to large aggregations, taking shelter in branched coral, under ledges, among the spines of @Diadema setosum@@, and in dark crevices. Feeds on small crustaceans and gastropods, also on small fishes.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 40 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 280 specimens in 1 taxon.
Water temperature and chemistry ranges based on 179 samples.

Environmental ranges
  Depth range (m): 0 - 82.3
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.048 - 1.204
  Salinity (PPS): 32.019 - 36.142
  Oxygen (ml/l): 4.149 - 5.079
  Phosphate (umol/l): 0.055 - 0.441
  Silicate (umol/l): 0.819 - 15.721

Graphical representation

Depth range (m): 0 - 82.3

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.048 - 1.204

Salinity (PPS): 32.019 - 36.142

Oxygen (ml/l): 4.149 - 5.079

Phosphate (umol/l): 0.055 - 0.441

Silicate (umol/l): 0.819 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: reef-associated. Inhabits reef flats and lagoon and seaward reefs to a depth of 40 m or more. Occurs singly or in small to large aggregations, taking shelter in dark crevices, branched coral, under ledges, and among the spines of @Diadema setosum@. Nocturnal species (Ref. 7300). Feeds on small crustaceans and gastropods, also on small fishes. Generally common (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Nocturnal species which occurs inshore (Ref. 75154). Found among corals or in caves (Ref. 9137, 58534). Present in seagrass beds at all life stages. Invertebrate and fish feeders (Ref. 41878).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Mouthbrooders (Ref. 240). Distinct pairing during courtship and spawning (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cheilodipterus quinquelineatus var 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cheilodipterus quinquelineatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATGGTCGGTACAGCGCTTAGCTTGCTTATTCGGGCAGAACTAAGCCAGCCAGGAGCCCTTCTTGGCGATGACCAAATTTATAACGTAATCGTTACGGCACATGCATTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGTTTCGGAAACTGGCTTATTCCTCTAATGATCGGTGCCCCCGACATGGCTTTCCCTCGAATAAATAACATGAGCTTCTGACTTCTTCCCCCTTCCTTCCTACTTCTACTTGCTTCTTCTGGCGTAGAGGCCGGGGCCGGAACTGGGTGGACTGTCTATCCCCCTCTTGCTGGCAATCTTGCCCACGCAGGAGCCTCCGTTGATTTAACAATCTTTTCCCTCCACTTAGCGGGTGTTTCCTCAATTCTAGGAGCAATTAATTTTATTACTACAATCATTAATATAAAACCCCCTGCTATTACTCAATATCAAACTCCACTGTTTGTCTGAGCGGTCCTTATTACGGCCGTCCTACTGCTTCTTTCTCTCCCCGTCCTAGCTGCCGGCATTACAATGCTACTCACTGATCGAAACCTAAATACAACCTTCTTTGACCCAGCAGGTGGTGGAGACCCAATTCTCTATCAACACTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cheilodipterus quinquelineatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cheilodipterus quinquelineatus

The five-lined cardinalfish, Cheilodipterus quinquelineatus, is a species of marine fish in the family Apogonidae. It is widespread throughout the tropical waters of the Indo-Pacific region, Red Sea included.[1] It can reach a maximum size of 13 cm in length.[2]

References[edit]

  1. ^ http://eol.org/pages/1012915/details#distribution
  2. ^ http://www.fishbase.org/summary/5482
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!