Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits coastal reefs, near rocky and coral areas (Ref. 9710). In Hong Kong live fish markets (Ref. 27253).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Arabian Sea to southern Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 600 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coastal reefs, near rocky and coral areas (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plectorhinchus cinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGGACAGCCCTAAGCCTGCTTATCCGAGCCGAACTAAGCCAACCTGGCGCTCTCTTAGGAGACGACCAGATCTACAACGTAATTGTTACGGCACATGCGTTTGTAATAATCTTTTTCATAGTAATGCCTATTCTAATCGGAGGGTTCGGAAACTGACTAGTCCCATTAATGATTGGGGCCCCCGACATAGCATTCCCCCGAATGAATAATATGAGCTTCTGACTGCTACCCCCATCCTTCCTTCTCCTTCTTGCCTCTTCAGGCGTAGAAGCTGGGGCGGGAACCGGTTGAACTGTCTACCCTCCACTGGCTGGTAATTTAGCACACGCGGGGGCATCCGTTGATTTAACAATTTTCTCCCTTCATCTAGCCGGTATCTCCTCAATTCTGGGGGCCATCAACTTCATCACAACTATTATTAACATGAAGCCCCCAGCTATTTCACAATACCAGACCCCCTTATTCGTTTGATCCGTACTGATTACTGCCGTTCTCCTACTCCTCTCCCTCCCAGTCCTTGCTGCCGGAATTACAATGCTCCTCACAGATCGCAACCTCAACACCACCTTCTTTGACCCAGCAGGAGGAGGTGACCCTATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plectorhinchus cinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!