Overview

Comprehensive Description

Biology

Carnivorous. Oviparous (Ref. 205). Eggs are encased in horny shells (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Known only from the eastern coast of Japan from Hokkaido to Tokyo. This species appears to be a regional endemic, most abundant in the northern and southern areas off Tohoku.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northwest Pacific: Sea of Japan and East China Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Dark chocolate-brown with large light colored spots.
  • Dolganov, V.N. 1982 New records for Rhinoraja longicauda (Rajidae, Elasmobranchii) and Hydrolagus barbouri (Chimaeridae, Holocephali). J. Ichthyol. 22(4):143-145. (Ref. 41158)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Deepwater edge of shelf and upper slope dweller reported from depths of 250 to 1,100 m, but seems to be most common at 600 to 800 m. Size range 18 to 86 cm TL; 8 to 48 cm body length (BDL).

Oviparous. A recent study of the distribution and reproductive biology indicates that this species appears to produce eggs all year round with no detectable spawning season. Populations appear to be partly segregated (Kokohu et al. 2003).

Life history parameters
Age at maturity (years): Unknown.
Size at maturity (precaudal length): Female: 55 cm PCL; Male: 48 cm PCL.
Longevity (years): Unknown.
Maximum size (total/body length): 86 cm TL; 48 cm BDL.
Size at birth: ~18 cm TL; 8 cm BDL.
Average reproductive age (years): Unknown.
Gestation time (months): Unknown.
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: Unknown.
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 100 - 1100 m (Ref. 58497)
  • Parin, N.V. 2001 An annotated catalogue of fishlike vertebrates and fishes of the seas of Russia and adjacent countries: Part 1. Orders Myxiniformes-Gasterosteiformes. J. Ichthyol. 41(Suppl.1):S51-S131. (Ref. 58497)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 820 - 820
  Temperature range (°C): 2.819 - 2.819
  Nitrate (umol/L): 41.796 - 41.796
  Salinity (PPS): 34.227 - 34.227
  Oxygen (ml/l): 1.220 - 1.220
  Phosphate (umol/l): 3.137 - 3.137
  Silicate (umol/l): 134.802 - 134.802
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 100 - 500m.
From 100 to 500 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A carnivore (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrolagus barbouri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTTCTTTTTGGTGCTTGAGCAGGCATAGTAGGAACTGCCCTTAGCCTATTAATCCGAGCTGAATTAAATCAACCGGGGGCTCTAATAGGGGATGACCAAATCTATAATGTTGTTGTTACTGCCCACGCTTTTGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGAGGATTTGGTAACTGACTTGTACCTTTAATAATTGGAGCACCAGATATAGCATTTCCCCGAATAAACAACATGAGCTTTTGACTCCTCCCTCCTTCTTTCTTACTACTTTTAGCCTCTGCCGGAGTAGAAGCAGGGGCCGGTACTGGATGAACTGTTTATCCCCCTCTAGCCGGAAATCTAGCTCATGCAGGAGCATCCGTAGACCTGACTATTTTCTCCCTCCACCTAGCCGGGATCTCCTCAATTTTAGCTTCCATTAACTTTATTACTACAATCATTAATATAAAACCTCCATCAATCACCCAATATCAGACCCCTTTATTCGTATGATCTATTTTAATTACTACTGTCCTTTTACTACTCTCTTTACCAGTTTTAGCAGCCGGTATTACAATATTACTCACAGACCGGAATCTGAATACAACATTCTTTGACCCAGCAGGAGGGGGAGACCCAATTTTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus barbouri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Dagit, D.D.

Reviewer/s
Nakaya,K., Sato, K., Kyne, P.M., Fowler, S.L. & Compagno, L.J.V. (Shark Red List Authority)

Contributor/s

Justification
Hydrolagus barbouri is a regional endemic known only from the Northwest Pacific off northern Japan at depths of 250 to 1,100 m. Little is known of the biology of this species, but it appears to be relatively common in research trawls and may be abundant in the area. Reproduction studies indicate that this species appears to produce eggs all year round with no detectable spawning season. Populations appear to be partly segregated. Not known to be targeted, but may be utilized when caught as bycatch in trawl fisheries and by subsistence fishers in the region. Probably not often caught as this species is most abundant in the deeper part of its range and may be at, or beyond the usual depths of the local trawl fishery. Potentially threatened as bycatch and possibly as a target species if local commercial trawl fishing effort increases in this region in the future, particularly due its restricted geographic range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Very little is known of population size and structure although the species appears to be somewhat abundant with captures including a wide range of juveniles and adults.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Known to occur in fair numbers in deepwater research trawls. Not known to be targeted, but may be utilized when caught as bycatch in trawl fisheries, although probably not often caught as this species is most abundant in the deeper part of its range and may be at, or beyond the usual depths of the local trawl fishery. Potentially threatened as bycatch and possibly as a target species if local commercial trawl fishing effort increases in this region in the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No management or conservation measures known to be in place.

The effective implementation of a national management plan (under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA?Sharks) will help to facilitate the conservation and management of all chondrichthyan species in the country. Japan?s National Plan Of Action was available in 2001.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ninespot chimaera

The ninespot chimaera, Hydrolagus barbouri, is a species of fish in the Chimaeridae family. It is endemic to Japan. Its natural habitat is open seas. It is threatened by habitat loss.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!