Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

Longnose butterflyfish can usually be found swimming alone or in small groups of up to five fish. Once an adult butterflyfish finds its mate it pairs up for life. When it is time to have babies, butterflyfish gather in large groups, and their eggs are carried away by the ocean current, floating near the surface before they hatch. The new hatchlings live in a layer of plankton for about 2 months, during which time they are almost as well-protected as their parents, with a spiky armor covering their bodies. When they are big enough, they swim by night to a reef, where they will live for the rest of their lives.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: forcepsfish (English), butterflyfish (English), mariposa (Espanol)
 
Forcipiger flavissimus Jordan & McGregor in Jordan & Evermann, 1898


Forcepsfish,     Longnose butterflyfish



Body a strongly compressed oval disc, greatest body depth 1.9-2.4 in SL; mouth small, with a distinct gape (hence forceps-like), at end of a long, slender snout that is ~ 50-60% of head depth; teeth long and slender; dorsal fin with XII spines, deeply notched between the spines, 22-24; anal rays III, 17-18; tail edge straight to rounded; lateral line complete, with 74-80 scales; scales rough, covering dorsal and anal fins as well as head and body.


Bright yellow; upper half of head and nape black, white below; a black spot on anal fin just below base of caudal fin.


Size: to 22 cm.

Inhabits rock and coral reefs; feeds on hydroids, small crustaceans, tubed feet of echinoderms, pedicillaria of sea urchins, and polychaete tentacles.

Depth: 1-145 m.

East Africa to the America; the SW Gulf of California; the Revillagigedos, Galapagos, Clipperton and Malpelo.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Common in exposed seaward reefs but also found in lagoon reefs (Ref. 9286). Benthopelagic (Ref. 58302). Solitary or in small groups of up to 5 individuals (Ref. 9286). Adults usually in pairs (Ref. 48636). Feed on a wide variety of animal prey including hydroids, fish eggs, small crustaceans but prefers tube feet of echinoderms, pedicilaria of sea urchins, and polychaete tentacles (Ref. 1602). Oviparous (Ref. 205), monogamous (Ref. 52884). Form pairs during breeding (Ref. 205). Second most important export in Hawaii (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Fun Facts

The longnose butterflyfish may be small, but it is a tricky fish! Because its body is so flat, the butterflyfish can easily escape predators by swimming in and out of tiny openings in the reef. When it is resting at night, its bright yellow color darkens, so it is not easily seen.

Do you see that black spot on its tail? That is its false eye. Its real eye is covered by a black line. When predators see the longnose butterflyfish, they think its head is its tail and its tail is its head! Confused? Good! That gives it more time to escape.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This is the most widely distributed of all butterflyfishes (Range size ~106 million km2) from values estimated by Jones et al. (2002) based on projections of distribution maps from Allen et al. (1998). It occurs throughout the Indo-Pacific from central Red Sea to Durban, South Africa to the west coast of central and northern South America north to southern Japan and the Hawaiian islands, south to central New South Wales, Lord Howe, Rapa and Easter Islands, including virtually all intervening tropical islands. It is absent from the Arabian Gulf, Gulf of Oman and Arabian Sea north of northern Yemen and the Laccadive Islands (India). It has been recorded at depths of 2-145 m.


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (Ref. 12484) to the Hawaiian and Easter islands, north to southern Japan, south to Lord Howe Island; throughout Micronesia. Eastern Pacific: southern Baja California, Mexico and from the Revillagigedo and Galapagos Islands (Ref. 5227, 11482).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, Madagascar and Mascarenes east to tropical eastern Pacific, north to southern Japan and Hawaiian Islands, south to Western Australia, New South Wales (Australia), Lord Howe Island, New Caledonia, Kermadec Islands, and R
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 145 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 19 - 25; Analspines: 3; Analsoft rays: 17 - 19
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 22.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 220 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

22.0 cm TL (male/unsexed; (Ref. 9710)); max. reported age: 18 years (Ref. 72479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

F. flavissimus has relatively shorter snout with a larger mouth, higher dorsal spine count, and absence of dark-centered scales on the thorax than F. longirostris.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Forcipiger flavissimus
Catalog Number: USNM 48528
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. McGregor
Locality: Socorro Island, Mexico, Revillagigedo Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species typically inhabits exposed outer reefs (particularly the crests) with abundant coral growth and caves and ledges. It is occasionally found within lagoon reefs. This species usually occurs in pairs, but may also be encountered as solitary animals or in small groups. It feeds on a wide variety of animal prey including hydroids, fish eggs, and small crustaceans, but prefers tube feet of echinoderms, pedicilaria of sea urchins, and polychaete tentacles (Myers 1991). This species may settle in live coral but is not not likely to be reliant on corals given its' latitudinal distribution beyond that of coral reefs. It is found on outer reef flats at various depths from shallow flats to very deep along walls (Kuiter 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 2 - 145 m (Ref. 89467)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 0.915 - 41
  Temperature range (°C): 24.488 - 28.954
  Nitrate (umol/L): 0.045 - 0.397
  Salinity (PPS): 34.124 - 35.368
  Oxygen (ml/l): 4.444 - 4.879
  Phosphate (umol/l): 0.083 - 0.543
  Silicate (umol/l): 1.056 - 4.062

Graphical representation

Depth range (m): 0.915 - 41

Temperature range (°C): 24.488 - 28.954

Nitrate (umol/L): 0.045 - 0.397

Salinity (PPS): 34.124 - 35.368

Oxygen (ml/l): 4.444 - 4.879

Phosphate (umol/l): 0.083 - 0.543

Silicate (umol/l): 1.056 - 4.062
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 114m.
From 1 to 114 meters.

Habitat: reef-associated. Common in exposed seaward reefs but also found in lagoon reefs. Solitary or in small groups of up to 5 individuals (Ref. 9286). Feeds on a wide variety of animal prey including hydroids, fish eggs, small crustaceans but prefers tubed feet of echinoderms, pedicilaria of sea urchins, and polychaete tentacles (Ref. 1602).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common in exposed seaward reefs but also found in lagoon reefs. Solitary or in small groups of up to 5 individuals (Ref. 9286). Feeds on a wide variety of animal prey including hydroids, fish eggs, small crustaceans but prefers tubed feet of echinoderms, pedicilaria of sea urchins, and polychaete tentacles (Ref. 1602). Second most important export in Hawaii (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), sea-stars/cucumbers/urchins, soft corals/hydroids, sessile crustacea, sessile worms, sessile molluscs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

WhyReef - Menu

The longnose butterflyfish dines on sea urchins, small sea stars, tiny crabs, and tiny shrimps. It also eats tiny animals in the sea called zooplankton, and when it is really hungry, it will eat turf algae. Because it eats both plants and animals, it is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Nematode Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 18 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Forcipiger flavissimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Forcipiger flavissimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCTTGAGCAGGGATAGTAGGTACAGCTTTAAGCCTACTTATCCGAGCAGAACTTAACCAACCAGGCTCTCTTCTAGGAGACGACCAGATTTACAATGTTATCGTGACAGCTCACGCGTTTGTAATAATTTTCTTTATAGTAATACCTATCATAATTGGAGGATTCGGCAACTGACTGATCCCTCTAATAATTGGGGCCCCAGATATGGCCTTCCCCCGAATAAATAATATAAGCTTCTGACTACTCCCCCCTTCCTTCTTCCTCCTCCTTGCCTCATCTGGCGTAGAAGCCGGGGCTGGTACTGGATGAACTGTCTACCCACCGCTCGCTGGCAACCTTGCCCACGCAGGGGCCTCTGTTGACTTAACAATCTTCTCTCTACACCTAGCAGGAATTTCTTCAATTCTTGGAGCCATCAATTTCATTACTACCATTATTAACATAAAACCCCCAGCTATAACCCAATATCAGACTCCACTTTTCGTGTGATCTGTCCTAATCACCGCCGTCTTGCTCCTCCTATCCCTCCCTGTTCTTGCCGCCGGAATTACAATGCTACTTACAGACCGAAACTTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGACCCTATTCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This is the most widespread of all butterflyfishes and occurs in coral reef and temperate reefs. It is quite heavily collected for the aquarium trade, but this does not seem to be substantially impacting the population. There do not appear to be any current threats to this species and it is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is generally common (G.R. Allen pers. comm. 2006). There is no evidence of population declines.

There is a small resident population in the tropical eastern Pacific. It is moderately common at Clipperton, but is only occasionally seen elsewhere in tropical eastern Pacific. According to Robertson and Allen (1996), this species is observed frequently enough to have a resident population at Clipperton Atoll. According to Aburto-Oropeza and Balart (2001), it is one of the rarest species at Los Islotes, Gulf of California, having an occurrence frequency below 10%. In Cabo Pulmo, Gulf of California, this species was not found, even though it was previously recorded there (Villarreal-Cavazos et al. 2000). This species was not observed during a survey conducted at the Galapagos archipelago (Edgar et al. 2004).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. Collection is limited and is not considered to be impacting the global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Threats

People hunt the longnose butterflyfish to sell to aquariums, and it is Hawaii’s second most important export. But it doesn’t make a good pet, and it cannot lead a full happy life in a small aquarium!

Reefs are in danger, and that means so is the home of the longnose butterflyfish!

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species-specific conservation measures in place for this species. It occurs within marine protected areas. Monitoring of the population trends and habitat status of this species is required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow longnose butterflyfish

The yellow longnose butterflyfish or forceps butterflyfish, Forcipiger flavissimus, is a species of marine fish in the family Chaetodontidae.

The yellow longnose butterflyfish is widespread throughout the tropical waters of the Indo-Pacific area from the eastern coast of Africa to Hawaii, Red Sea included, and is also found in the eastern Pacific Ocean from Baja California to the Revillagigedo Islands and the Galapagos.[2][3]

It is a small fish which grows up to 22 cm in length.[3][4]

This species can also be found in the aquarium trade.

Territoriality[edit]

Being territorial, yellow longnose butterflyfish patrol their patches of coral with a monogamous partner. However, instances of overt aggression among F. flavissimus have been observed between territory holders and individuals of the same sex. Chasing is rare, but when it does occur, males chase males and females chase females.[5] Females defend food resources from other females, while males defend territories containing a female from other males.[6]

Territoriality is a favorable strategy for a species to adopt primarily when resources are temporally stable, predictable, and evenly distributed throughout a territory.[7] Territoriality is commonly displayed by benthic-feeding longnose butterflyfish, therefore, because their main dietary resources fulfill these characteristics.[8] Their monogamous pairing appears to be closely linked to their territorial behavior.[8] Although several could cause a species to evolve monogamous behavior, the necessity for biparental care does not applies to longnose butterflyfish because they lay pelagic, or freely floating, eggs. One source of selective pressure responsible for the monogamous pairs observed could be the advantage of territorial defense it provides. Monogamy is favored when a pair makes the defense of one or more resources more efficient than defense by a solitary individual.[8] Longnose Butterflyfish pairs have been confirmed by studies to be heterosexual and pair fidelity has been observed for periods of up to seven or more years.[5]

Besides the advertisement displays accomplished through monogamous pairing, territorial domination by longnose butterflyfish has also been observed by means of acoustic behaviors, which provide important cues and social signals during fish communication.[9] Emitting sounds through complicated body movements is another technique they use to advertise territorial boundaries. Potential rivals are able to assess body size of a competitor based on the duration and intensity of the sound a yellow longnose butterflyfish produces.[9] The duration and intensity of the sounds emitted during agnostic behaviors, such as the defense of one's territory, often predict the ability of an individual to secure that territory.[9] A sound of long duration and high intensity, therefore, often indicates an individual has a large territory. Defending territory is the strategy these species adopt to compete for and maximize their claims over resources.

References[edit]

  1. ^ Myers, R. & Pratchett, M. 2010. Forcipiger flavissimus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 21 October 2013.
  2. ^ http://www.iucnredlist.org/details/165716/0
  3. ^ a b http://www.fishbase.org/summary/5584
  4. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  5. ^ a b E. A. Whiteman, I. M. Cote (March 2007). "Monogamy in marine fishes". Biological Reviews 79 (2). doi:10.1017/S1464793103006304. Retrieved 2013-09-17. 
  6. ^ "Environmental determinants of butterflyfish social systems". Environmental Biology of Fishes 25. May 1989. Retrieved 2013-09-17. 
  7. ^ Bouchon-Navaro, Yolande (December 1986). "Partitioning of food and space resources by chaetodontid fishes on coral reefs". Elsevier 103. doi:10.1016/0022-0981(86)90130-9. Retrieved 2013-09-17. 
  8. ^ a b c Callum M. Roberts, Rupert F. G. Ormond (May 1992). "Butterflyfish social behaviour, with special reference to the incidence of territoriality: a review". Environmental Biology of Fishes 34 (1). Retrieved 2013-09-17. 
  9. ^ a b c Kelly S. Boyle and Timothy C. Tricas (November 2011). "Sound production in the longnose butterflyfishes (genus Forcipiger): cranial kinematics, muscle activity and honest signals". The Journal of Experimental Biology. doi:10.1242/jeb.062554. Retrieved 2013-09-17. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!