Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in reef flats, lagoon and seaward reefs and sometimes in turbid waters subject to freshwater runoff. Swim in pairs. Omnivorous, feed on algae, coral polyps, crustaceans and worms (Ref. 5503). Oviparous (Ref. 205), monogamous (Ref. 52884). Stable monogamous pairs with both pair members jointly defending a feeding territory against other pairs (Ref. 58331), but often accompanies other species without being aggressive. Easily maintained in tanks.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is very widespread from Socotra south to Natal, South Africa across the Indo-Pacific to the Line and Gambier Islands in Polynesia, north to southern Japan and south to central New South Wales, Lord Howe and Rapa Iti (G.R. Allen pers. comm. 2006). Its geographic range is estimated to be ~76 million km2, from values estimated by Jones et al. (2002) based on projections of distribution maps from Allen et al. (1998). It is found at depth of 1-30m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Marshall Islands, northern Line Islands and Tuamotu Archipelago, north to southern Japan, south to Kimberleys (Western Australia), Lord Howe Island, New Caledonia and Austral Islan
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea (Ref. 5372) and East Africa to the Line and Tuamoto islands, north to southern Japan, south to the Lord Howe and the Austral islands. Closely related to Chaetodon decussatus.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 22 - 25; Anal spines: 2 - 3; Analsoft rays: 19 - 22
  • Burgess, W.E. 1978 Butterflyfishes of the world. A monograph of the Family Chaetodontidae. T.F.H. Publications, Neptune City, New Jersey. (Ref. 4855)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 230 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Black bands over head and tail (Ref. 48636). Snout length 2.5-3.2 in HL. Body depth 1.5-1.7 in SL (Ref. 90102).
  • Burgess, W.E. 1978 Butterflyfishes of the world. A monograph of the Family Chaetodontidae. T.F.H. Publications, Neptune City, New Jersey. (Ref. 4855)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits reef flats and lagoon and shallow seaward reefs and sometimes in turbid waters subject to freshwater runoff. Hardly territorial and often accompanies other species without being agressive. Swims in pairs. Omnivorous, feeds on algae, coral polyps, crustaceans and worms (Ref. 5503). Easily maintained in tanks.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in most coral reef habitats, from inner coastal reef flats to outer seaward slopes. Occurs singly, in pairs, or in small groups. The diet consists of anemones, coral polyps, polychaete worms and algae. The species tolerates a wide range of ecological conditions including influx of freshwater near stream mouths and turbid water (G.R. Allen pers. comm. 2006).

This species rarely consumes coral on the Great Barrier Reef (Pratchett 2005), but does so frequently in the Seychelles (Graham et al. 2006). It has declined at Moorea between 1979 and 2003 (Berumen and Pratchett 2006), though the explanation for this is unknown, given that it is not thought to be reliant on live coral.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 30m.
Recorded at 30 meters.

Habitat: reef-associated. Found in reef flats, lagoon and seaward reefs and sometimes in turbid waters subject to freshwater runoff. Swims in pairs. Omnivorous, feeds on algae, coral polyps, crustaceans and worms (Ref. 5503). Hardly territorial and often accompanies other species without being agressive. Easily maintained in tanks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 5 - 30 m (Ref. 58304)
  • Heemstra, P.C. and E. Heemstra 2004 Coastal fishes of Southern Africa. National Inquiry Service Centre (NISC) and South African Institute for Aquatic Biodiversity (SAIAB), Grahamstown. 488 p. (Ref. 58304)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 64 samples.

Environmental ranges
  Depth range (m): 0.4575 - 150
  Temperature range (°C): 24.633 - 29.336
  Nitrate (umol/L): 0.016 - 0.678
  Salinity (PPS): 34.090 - 35.924
  Oxygen (ml/l): 4.454 - 4.851
  Phosphate (umol/l): 0.083 - 0.270
  Silicate (umol/l): 0.974 - 4.612

Graphical representation

Depth range (m): 0.4575 - 150

Temperature range (°C): 24.633 - 29.336

Nitrate (umol/L): 0.016 - 0.678

Salinity (PPS): 34.090 - 35.924

Oxygen (ml/l): 4.454 - 4.851

Phosphate (umol/l): 0.083 - 0.270

Silicate (umol/l): 0.974 - 4.612
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in reef flats, lagoon and seaward reefs and sometimes in turbid waters subject to freshwater runoff. Swims in pairs. Omnivorous, feeds on algae, coral polyps, crustaceans and worms (Ref. 5503). Hardly territorial and often accompanies other species without being aggressive. Easily maintained in tanks.
  • Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Uronema infection. Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 2000 Diseases in marine aquarium fish: causes, development, symptoms, treatment. Bassleer Biofish, Westmeerbeek, Belgium, 96 p. Second edition. (Ref. 41806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205). Stable monogamous pairs with both pair members jointly defending a feeding territory. Pelagic larvae settle to shallow (
  • Thresher, R.E. 1984 Reproduction in reef fishes. T.F.H. Publications, Inc. Ltd., Neptune City, New Jersey. 399 p. (Ref. 240)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon vagabundus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGGATAGTGGGTACTGCCCTAAGTCTGCTCATTCGAGCAGAACTCAGCCAACCAGGCTCCCTCCTGGGCGACGACCAGATCTATAACGTAATTGTTACGGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGAAACTGACTGATTCCTCTAATAATTGGAGCCCCAGATATAGCTTTTCCTCGGATAAATAACATGAGCTTTTGGCTCCTGCCCCCCTCCTTTTTCCTACTCCTTGCCTCTTCTGGCGTAGAGTCCGGGGCTGGTACTGGATGAACGGTTTATCCCCCACTAGCTGGCAACCTAGCACACGCCGGAGCATCCGTTGATCTAACCATCTTCTCCCTCCACCTCGCAGGAGTTTCCTCCATCCTTGGGGCAATTAACTTCATCACAACAATTCTCAACATGAAACCCCCTGCCATATCTCAGTACCAAACCCCTCTTTTCGTATGATCTGTTCTAATTACAGCTGTCCTGCTTCTCCTATCCCTACCCGTTCTTGCAGCCGGGATCACAATACTCCTTACAGATCGAAACCTCAATACAACCTTTTTCGACCCCGCAGGAGGGGGCGACCCTATTCTGTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon vagabundus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
There have been declines in the abundance of Chaetodon vagabundus in some areas and research is required to understand apparent reliance on live corals. Given that this species is very widespread and typically abundant, it is unlikely that localized declines have substantially affected the global population. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is very abundant (e.g., mean of 1.3 individuals per 200 m2 in the northern Great Barrier Reef; Pratchett and Berumen 2008) throughout much of its geographical range. There have been slight declines in abundance recorded in Moorea, French Polynesia, between 1979 and 2003 (Berumen and Pratchett 2006), but it is otherwise stable (Pratchett et al. 2006).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
While this species has exhibited long-term declines in Moorea, there is apparent no reason why this species should depend on live coral. There do not appear to be any other major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Research is required to confirm or understand the apparent reliance on live corals for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Edwards, A.J. and A.D. Shepherd 1992 Environmental implications of aquarium-fish collection in the Maldives, with proposals for regulation. Environ. Conserv. 19:61-72. (Ref. 4907)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Vagabond butterflyfish

Not to be confused with the Indian Vagabond Butterflyfish (C. decussatus).

The Vagabond Butterflyfish, Chaetodon vagabundus, is a species of butterflyfish (family Chaetodontidae). It is found in the Indo-Pacific region from the Red Sea and off East Africa as far east as the Tuamotu Islands, north to southern Japan and south to the Austral Islands.[2]

It belongs to the large subgenus Rabdophorus which might warrant recognition as a distinct genus. In this group, it almost certainly is a rather close relative of the Threadfin Butterflyfish (C. auriga) and the Indian Vagabond Butterflyfish (C. decussatus). The latter might be closer to the Threadfin Butterflyfish; as C. vagabundus has yielded abnormal mtDNA 12S rRNA sequence data this is hard to say however. The C. auriga species group shares the characteristic pattern of two areas of ascending and descending oblique lines; species differ conspicuously in hindpart coloration.[3]

Chaetodon vagabundus are found in reef flats, lagoons and seaward reefs, and sometimes in turbid waters subject to freshwater runoff. They are omnivorous, known to feed on algae, coral polyps, crustaceans and worms. These oviparous, monogamous fish form stable pairs with both pair members jointly defending a feeding territory against other pairs. However they often accompany other species without being aggressive. By the standards of their genus, they are easily maintained in tanks.[2]

Footnotes[edit]

  1. ^ Myers, R. & Pratchett, M. 2010. Chaetodon vagabundus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ a b FishBase (2008)
  3. ^ Fessler & Westneat (2007), Hsu et al. (2007)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!