Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Territorial species which occur in shallow lagoon and semi-protected seaward reefs (Ref. 48636). Benthopelagic (Ref. 58302). Closely associated with tabular and staghorn Acropora corals upon which they feed on their polyps and mucus. Solitary or in pairs. Juveniles secretive among coral branches (Ref. 48636). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is very widespread throughout the Indo-west and central Pacific, from the Red Sea to the Society Islands. North to southern Japan, and south to Lord Howe Island and Rapa (Pyle 2001, G.R. Allen pers. comm. 2006). It has been recorded as a vagrant from the Hawaiian Islands. The range size is ~76.2 million km2, from values estimated by Jones et al. (2002) based on projections of distribution maps from Allen et al. (1998). It is found at depths of 2-30 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands, northern Line Islands and Tuamotu Archipelago, north to southern Japan, south to Exmouth Gulf (Western Australia), New South Wales (Aust
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Hawaiian and Society islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 15; Dorsal soft rays (total): 14 - 16; Anal spines: 3 - 5; Analsoft rays: 13 - 15
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 4859))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

This territorial species occurs in shallow lagoon and semi-protected seaward reefs. Closely associated with tabular and staghorn @Acropora@ corals upon which it feeds on their polyps and mucus. Solitary or in pairs.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body elongate; color is generally white with narrow chevron markings. Juveniles have a mostly yellow tail and a broad black band extending from the rear of the dorsal fin to the rear of the anal fin. Tail pattern and posterior part of body changes dramatically with growth (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Chaetodon trifascialis is an obligate corallivore with a strong preference and apparent survival dependency (Berumen and Pratchett 2008) on Acropora hyacinthus but it has also been observed feeding on: A. intermedia (now recognized as A. nobilis and A. formosa), A. gemmifera, A. millepora, A. florida, A. cytherea, A. tenuis, A. robbusta, A. cerialis (Pratchett 2005), A. clathrata, P. damicornis (Graham 2007), A. aspera (Reese 1981), Stylophora pistillata, and Pocillopora eydouxi (Samways 2005). Most commonly occurs singly, sometimes also in pairs.


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated. This territorial species occurs in shallow lagoon and semi-protected seaward reefs. Closely associated with tabular and staghorn @Acropora@ corals upon which it feeds on their polyps and mucus. Solitary or in pairs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 30 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 108 specimens in 1 taxon.
Water temperature and chemistry ranges based on 96 samples.

Environmental ranges
  Depth range (m): 0.7625 - 53
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.048 - 1.251
  Salinity (PPS): 32.200 - 36.148
  Oxygen (ml/l): 4.427 - 4.727
  Phosphate (umol/l): 0.083 - 0.351
  Silicate (umol/l): 0.721 - 4.752

Graphical representation

Depth range (m): 0.7625 - 53

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.048 - 1.251

Salinity (PPS): 32.200 - 36.148

Oxygen (ml/l): 4.427 - 4.727

Phosphate (umol/l): 0.083 - 0.351

Silicate (umol/l): 0.721 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Both males and females hold separate territories, which are sometimes adjacent to each other. Occur in shallow lagoon and semi-protected seaward reefs. Closely associated with tabular and staghorn Acropora corals upon which it feeds on their polyps and mucus. Solitary or in pairs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaetodon trifascialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chaetodon trifascialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCTCTATTTAGTATTCGGTGCTTGAGCCGGAATAGTGGGCACCGCTTTAAGTCTGCTCATCCGAGCAGAGCTTAGCCAACCAGGCACTCTCCTAGGTGACGACCAGATCTATAATGTAATTGTTACGGCGCATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATGATCGGAGCCCCTGATATGGCCTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTGCCCCCCTCCTTCTTCCTGCTACTCGCCTCTTCTGGTGTCGAGTCCGGAGCTGGGACGGGATGAACGGTCTACCCCCCACTAGCTAGCAACCTAGCACACGCGGGAGCATCCGTTGACCTAACCATTTTCTCCCTTCACCTCGCAGGGGTTTCCTCTATTCTTGGGGCAATCAATTTCATCACAACAATCCTCAACATAAAACCCCCCGCCATATCTCAGTACCAAACCCCTCTTTTCGTATGGTCCGTCTTAATTACAGCCGTTCTACTTCTTCTATCCCTTCCTGTCCTTGCAGCTGGGATTACAATACTTCTCACAGACCGGAATCTGAATACAACTTTCTTTGATCCTGCTGGAGGAGGTGACCCCATTCTATATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Carpenter, K.E. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

This is a widespread species with a strong dependency on corals that have undergone widespread population declines ranging from 20 to 37% because of coral reef loss. It has been eliminated on reefs that undergo massive bleaching events. Chaetodon trifascialis has a strong dependency on a species of coral (Acropora hyacinthus) that is listed as Near Threatened and although it has been seen to feed on at least 14 other coral species variously listed as Least Concern (seven species), Near Threatened (six species) and Vulnerable (one species), all of these corals have shown substantial population declines because of coral reef loss throughout the Indo-Pacific. We infer that population declines of C. trifascialis are similar to those of A. hyacinthus (and other species it feeds on) and therefore list this species as Near Threatened (nearly meeting VU A3ce with an estimated generation length of between six and seven years).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common (e.g., mean of 0.66 individuals per 200 m2 in northern Great Barrier Reef; Pratchett and Berumen 2008), but very vulnerable to changes in the abundance of its preferred coral prey, tabular Acropora (Berumen and Pratchett 2006, Pratchett et al. 2006). It went locally extinct (100% decline in abundance) before and after a severe bleaching event (90% coral loss) in the central Great Barrier Reef (Pratchett et al. 2006). The abundance and persistence of this species is highly linked to Acropora corals (including A. hyacinthus and A. cytherea). The declines of these coral species can be used as a proxy for declines in abundance of C. trifascialis.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Chaetodon trifascialis is an obligate corallivore on a number of corals that are susceptible to bleaching events and have undergone population declines throughout the Indo-Pacific ranging from 20 to 37% because of reef loss and have been assessed under Red List Criteria (Carpenter et al. 2008). It has been observed feeding on: Acropora hyacinthus (with a strong preference and apparent survival dependency); A. intermedia (now recognized as A. nobilis and A. formosa); A. gemmifera; A. millepora; A. florida; A. cytherea; A. tenuis; A. robbusta; A. cerialis (Pratchett, 2005); A. clathrata; P. damicornis (Graham, 2007); A. aspera (Reese, 1981); Stylophora pistillata; and Pocillopora eydouxi (Samways, 2005). On reefs where it was observed in transects, it has been completely absent from transects after massive bleaching events (Pratchett et al. 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Monitoring of this species is needed in conjunction with coral monitoring, as well as determination of the degree of co-dependence between this species and corals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)   http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chevron butterflyfish

Not to be confused with Chaetodon trifasciatus (Melon Butterflyfish). See also Chaetodon tricinctus (Three-striped Butterflyfish) and Three-banded Butterflyfish.

For the Philippines Chevron Butterflyfish, see Chaetodon xanthurus. "Triangulate butterflyfish" redirects here; for the triangular butterflyfishes, see C. baronessa and Chaetodon triangulum

Chaetodon trifascialis is known as the Chevron Butterflyfish, Triangulate Butterflyfish or V-lined Butterflyfish. It is a species of butterflyfish (family Chaetodontidae) found in the Indo-Pacific from the Red Sea and East Africa to the Hawaiian and Society Islands.[2]

Information[edit source | edit]

Adults have an elongate white body with narrow chevron markings and may be up to 18 cm (7 in) in length.[2] Juveniles have a mostly yellow tail and a broad black band extending from the rear of the dorsal fin to the rear of the anal fin. The tail pattern and the coloring of the posterior part of body changes dramatically with growth, with the tail entirely black with a thin yellow outline and the hind part of the body not differing in color from the areas further forward in adults.Juvenile of Chevron butterflyfish

A juvenile Chevron butterflyfish, demonstrating the color difference compared to adult fish.

This peculiar species, with its peculiar age-dependent color and elongated outline, has been placed in a monotypic subgenus Megaprotodon. Its closest living relatives seem to be the species of the subgenera Discochaetodon (e.g. Eight-banded Butterflyfish, C. octofasciatus) and Tetrachaetodon (e.g. Mirror Butterflyfish, C. speculum). These, and perhaps other subgenera, would use Megaprotodon as genus name if Chaetodon is split up.[3]

Chaetodon trifascialis is a territorial species which occurs in semi-protected seaward and shallow lagoon reefs, closely associated with tabular and staghorn (Acropora) corals, the polyps and mucus of which they eat. They occur at depths ranging from 2–30 m. Adults are either seen to swim alone or (particularly in the breeding season) in pairs, while juveniles are secretive among coral branches. They are oviparous.[2]

References[edit source | edit]

  1. ^ Carpenter, K.E. & Pratchett, M. (2009). "Chaetodon trifascialis". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 12 April 2011. 
  2. ^ a b c FishBase (2008)
  3. ^ Fessler & Westneat (2007), Hsu et al. (2007)

Notes[edit source | edit]

  • Fessler, Jennifer L. & Westneat, Mark W. (2007): Molecular phylogenetics of the butterflyfishes (Chaetodontidae): Taxonomy and biogeography of a global coral reef fish family. Mol. Phylogenet. Evol. 45(1): 50–68. doi:10.1016/j.ympev.2007.05.018 (HTML abstract)
  • FishBase (2008): Chaetodon trifascialis. Version of 2008-JUL-24. Retrieved 2008-SEP-01.
  • Hsu, Kui-Ching; Chen, Jeng-Ping & Shao, Kwang-Tsao (2007): Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups. Raffles Bulletin of Zoology Supplement 14: 77-86. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!