Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An uncommon species found in areas of rich coral growth of lagoon and protected reef flats and seaward reefs (Ref. 9710). Often in pairs (Ref. 9710, 48636). Feed on sea anemones, polychaetes, and octocorallian and scleractinian coral polyps. Oviparous (Ref. 205). Form pairs during breeding (Ref. 205). In captivity, this species should be fed algae stones and the so-called 'feeding stones' which are prepared by spreading the food pulp over the stone.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is distributed from Sri Lankaand the Andaman Seaacross the tropical southern Pacific Ocean to the Tuamotu Archipelago (Pyle 2001), north to southern Japan and the Ryukyu Islands and south to the southern Great Barrier Reef (Australia), New Caledonia and Tonga. It inhabitsdepths between 1-20 m.

The overall geographic range of the species is ~34.3 million km2, from values estimated by Jones et al. (2002) based on projections of distribution maps from Allen et al. (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Sri Lanka to the Tuamoto Islands, north to southern Japan, south to the Great Barrier Reef; Palau (Belau) to the eastern Caroline Islands in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 21 - 23; Analspines: 3; Analsoft rays: 18 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body color is yellow with cross-hatched pattern on the sides. A dark black spot is sometimes present under the spinous portion of the dorsal fin. A black bar runs across the eye. The dorsal, anal and caudal fins have a dark stripe the position of which varies with age (Ref. 4855). Snout length 2.1-2.6 in HL. Body depth 1.4-1.8 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in areas of rich coral growth from coral reef lagoons to seaward reefs. It is usually observed in pairs.It feeds on a variety of items including coral polyps, anemones, and polychaetes. This species appears to settle in live coral (Allen et al. 1998), but there have not been any documented declines in the abundance of this species following coral bleaching and coral loss.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 0.61 - 16.775
  Temperature range (°C): 27.859 - 29.336
  Nitrate (umol/L): 0.050 - 0.309
  Salinity (PPS): 34.090 - 35.837
  Oxygen (ml/l): 4.454 - 4.630
  Phosphate (umol/l): 0.080 - 0.223
  Silicate (umol/l): 1.097 - 1.684

Graphical representation

Depth range (m): 0.61 - 16.775

Temperature range (°C): 27.859 - 29.336

Nitrate (umol/L): 0.050 - 0.309

Salinity (PPS): 34.090 - 35.837

Oxygen (ml/l): 4.454 - 4.630

Phosphate (umol/l): 0.080 - 0.223

Silicate (umol/l): 1.097 - 1.684
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 1 - 15 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 0.61 - 16.775
  Temperature range (°C): 27.859 - 29.336
  Nitrate (umol/L): 0.050 - 0.309
  Salinity (PPS): 34.090 - 35.837
  Oxygen (ml/l): 4.454 - 4.630
  Phosphate (umol/l): 0.080 - 0.223
  Silicate (umol/l): 1.097 - 1.684

Graphical representation

Depth range (m): 0.61 - 16.775

Temperature range (°C): 27.859 - 29.336

Nitrate (umol/L): 0.050 - 0.309

Salinity (PPS): 34.090 - 35.837

Oxygen (ml/l): 4.454 - 4.630

Phosphate (umol/l): 0.080 - 0.223

Silicate (umol/l): 1.097 - 1.684
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated. An uncommon species found in areas of rich coral growth of lagoon and protected reef flats and seaward reefs (Ref. 9710). Often in pairs (Ref. 9710). Feeds on sea anemones, polychaetes, and octocorallian and scleractinian coral polyps. In captivity, this species should be fed algae stones and the so-called 'feeding stones' which are prepared by spreading the food pulp over the stone.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

An uncommon species found in areas of rich coral growth of lagoon and protected reef flats and seaward reefs (Ref. 9710). Often in pairs (Ref. 9710). Feeds on sea anemones, polychaetes, and octocorallian and scleractinian coral polyps. In captivity, this species should be fed algae stones and the so-called 'feeding stones' which are prepared by spreading the food pulp over the stone (Ref. 4859).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon rafflesii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCTTGAGCTGGGATAGTAGGCACTGCCCTAAGTCTGCTCATCCGAGCAGAACTCAGCCAACCAGGCTCCCTCCTGGGCGACGACCAGATCTATAACGTAATTGTCACAGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGAAACTGACTGATTCCTCTAATAATTGGAGCCCCAGACATGGCCTTCCCTCGAATAAATAACATGAGCTTTTGGCTCCTGCCCCCCTCCTTCTTCCTACTCCTCGCCTCTTCTGGCGTAGAGTCCGGGGCTGGTACCGGATGAACGGTTTATCCCCCACTAGCCGGCAACCTGGCACACGCCGGGGCATCCGTTGATCTAACCATCTTCTCCCTCCATCTCGCAGGAGTTTCCTCCATCCTTGGGGCAATTAATTTTATCACAACAATTCTCAACATGAAGCCCCCTGCCATATCTCAGTACCAAACCCCTCTTTTCGTGTGATCTGTTTTAATTACAGCCGTCCTGCTTCTCCTATCCCTTCCCGTTCTTGCAGCTGGGATCACAATACTCCTTACAGACCGAAATCTAAATACAACCTTTTTCGACCCCGCAGGAGGAGGTGATCCCATCCTGTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon rafflesii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and sometimes common. Research is required to assess it dependence on live coral at settlement, but there are no other major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is generally uncommon, with the exception of some parts of New Guinea (G.R. Allen pers. comm. 2006). There are no reported declines in the abundance of this species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. Aquarium collections are limited and this species has not exhibited any declines in abundance following coral bleaching and coral loss.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Research is required to assess its reliance on live corals for settlement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Latticed butterflyfish

The Latticed Butterflyfish, Chaetodon rafflesii, is a species of butterflyfish (family Chaetodontidae). It is found in the Indo-Pacific region from Sri Lanka to the Tuamotu Islands, north to southern Japan, south to the Great Barrier Reef, and from Palau (Belau) to the eastern Caroline Islands in Micronesia.[2]

It grows to a maximum of 18 cm (7.1 in) long,[3] but the common length is 15 cm (5.9 in). The body color is yellow with a cross-hatched pattern of darker lines on the sides; it has a vertical black eyestripe and a vertical black line in the caudal fin. The peculiarly-patterned C. rafflesii belongs to the large subgenus Rabdophorus which might warrant recognition as a distinct genus. In this group, it seems to represent a rather unique lineage, with perhaps just the White-faced Butterflyfish (C. mesoleucos) being less distantly related.[4]

The Latticed Butterflyfish is an uncommon species found in areas of rich coral growth of lagoons and protected reef flats and seaward reefs from 1–20 m depth. It feeds on sea anemones, polychaetes, and octocorallian and scleractinian coral polyps.[2]

Footnotes[edit]

  1. ^ Myers, R. & Pratchett, M. 2010. Chaetodon rafflesii. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 10 September 2013.
  2. ^ a b FishBase (2008)
  3. ^ Dianne J. Bray, 2011, Lattice Butterflyfish, Chaetodon rafflesii, in Fishes of Australia, accessed 07 Oct 2014, http://www.fishesofaustralia.net.au/home/species/2396
  4. ^ Fessler & Westneat (2007), Hsu et al. (2007), FishBase (2008)

References[edit]

  • Fessler, Jennifer L. & Westneat, Mark W. (2007): Molecular phylogenetics of the butterflyfishes (Chaetodontidae): Taxonomy and biogeography of a global coral reef fish family. Mol. Phylogenet. Evol. 45(1): 50–68. doi:10.1016/j.ympev.2007.05.018 (HTML abstract)
  • FishBase (2008): Chaetodon rafflesii. Version of 2008-JUL-24. Retrieved 2008-SEP-01.
  • Hsu, Kui-Ching; Chen, Jeng-Ping & Shao, Kwang-Tsao (2007): Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups. Raffles Bulletin of Zoology Supplement 14: 77-86. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!