Overview

Comprehensive Description

Biology

Common in coral rich areas and clear waters of lagoon and seaward reefs. Sometimes found on outer subtidal reef flats (Ref. 1602). Juveniles secretive (Ref. 48636). Feed on filamentous algae, corals, and benthic invertebrates. Often in pairs during breeding (Ref. 205), monogamous (Ref. 52884). Oviparous (Ref. 205). Occasionally hybridize with C. pelewensis in the southern part of its range (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Christmas Island in the eastern Indian Ocean to the Line Islands, north to the Ryukyu Islands, south to Rowley Shoals and the northern Great Barrier Reef; throughout Micronesia. Replaced by Chaetodon guttatissimus in the Indian Ocean (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Mainly distributed throughout the south Pacific, from western Indonesia to the Line Islands, also ranging north to the Ryukyu Islands (G.R. Allen pers. comm. 2006). It is found at 1-45 m depths (Allen et al. 1998). Range size ~28.2 million km2, from values estimated by Jones et al. (2002) based on projection of distribution maps from Allen et al. (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 22 - 25; Analspines: 3; Analsoft rays: 17 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 120 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Overall color is brownish yellow with vertical rows of spots forming bands on the upper portions of the sides. A black-edged orange bar runs across the eye. The posterior edge of the caudal fin is transparent. Caudal peduncle is bright orange.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 45 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Chaetodon punctatofasciatus inhabits coral reefs, is corallivorous and forms pairs (Pyle 2001). The species is most commonly found on outer reef slopes, but also occurs in clear water lagoons and reef flats rich in coral growth.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 0.915 - 1628
  Temperature range (°C): 26.287 - 28.954
  Nitrate (umol/L): 0.045 - 0.822
  Salinity (PPS): 34.131 - 35.893
  Oxygen (ml/l): 4.387 - 4.651
  Phosphate (umol/l): 0.092 - 0.226
  Silicate (umol/l): 1.056 - 3.868

Graphical representation

Depth range (m): 0.915 - 1628

Temperature range (°C): 26.287 - 28.954

Nitrate (umol/L): 0.045 - 0.822

Salinity (PPS): 34.131 - 35.893

Oxygen (ml/l): 4.387 - 4.651

Phosphate (umol/l): 0.092 - 0.226

Silicate (umol/l): 1.056 - 3.868
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 45m.
From 1 to 45 meters.

Habitat: reef-associated. Common in coral rich areas and clear waters of lagoon and seaward reefs. Sometimes found on outer subtidal reef flats (Ref. 1602). Feeds on filamentous algae, corals, and benthic invertebrates. Often in pairs. Occasionally hybridizes with @C. pelewensis@ in the southern part of its range (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Common in coral rich areas and clear waters of lagoon and seaward reefs. Sometimes found on outer subtidal reef flats (Ref. 1602). Feeds on filamentous algae, corals, and benthic invertebrates. Often in pairs. Occasionally hybridizes with C. pelewensis in the southern part of its range (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon punctatofasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTCGGTGCTTGAGCTGGAATAGTGGGCACCGCTTTAAGTCTACTTATCCGAGCAGAGCTTAGTCAACCAGGCAGTCTTCTAGGCGACGATCAAATCTATAATGTAATCGTTACGGCACATGCATTCGTGATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTGATTCCTCTAATGATTGGAGCCCCTGATATGGCCTTCCCTCGTATGAATAACATGAGCTTTTGACTCCTGCCCCCTTCCTTCTTCCTCCTTCTTGCCTCTTCTGGTGTGGAGTCTGGGGCTGGCACTGGATGAACAGTTTATCCGCCACTGGCCGGCAATCTGGCACATGCCGGAGCATCTGTTGATCTAACCATCTTCTCCCTTCACCTTGCAGGGATTTCCTCTATTCTTGGGGCCATTAACTTCATCACAACGATCCTCAATATGAAACCCCCCGCCATATCTCAATATCAAACCCCTCTCTTCGTATGATCCGTCCTAATTACAGCTGTCCTTCTTCTTCTATCACTTCCTGTTCTTGCAGCCGGGATTACAATGCTCCTAACAGATCGAAATCTAAACACAACCTTTTTTGATCCGGCGGGAGGCGGCGACCCGATTCTGTACCAGCATTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon punctatofasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Craig, M.T. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, presumed large population and no apparent major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is generally common with stable populations (G.R. Allen pers. comm. 2006).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This species relies on live coral for food and/or recruitment, and may therefore decline in abundance following climate-induced coral depletion (Pratchett et al. 2008). Currently this is not considered a threat, and there appear to be no other major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Monitoring of this species is needed in conjunction with coral monitoring, as well as determination of the degree of co-dependence between this species and corals.

Further research is required to address issues of hybridization between C. pelewensis and C. punctofasciatus.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spotband butterflyfish

The Spot-banded Butterflyfish or spotband butterflyfish (Chaetodon punctatofasciatus) is a species of butterflyfish (family Chaetodontidae).

It is found in the Indo-Pacific region from Christmas Island in the eastern Indian Ocean to the Line Islands, north to the Ryukyu Islands, south to the Rowley Shoals and the northern Great Barrier Reef, and throughout Micronesia. Replaced by its close relative the Peppered Butterflyfish (C. guttatissimus) in the Indian Ocean, these two species are sympatric from Christmas Island to Bali.[1]

This is one of the members of the subgenus Exornator. With the Peppered Butterflyfish it is part of a close-knit group which also includes the Pebbled Butterflyfish (C. multicinctus) and the Sunset Butterflyfish (C. pelewensis). It is suspected that these four are able to produce fertile hybrids. If the genus Chaetodon is split up, Exornator might become a subgenus of Lepidochaetodon.[2]

The Spot-banded Butterflyfish grows to a maximum of 12 cm long. Its body is pale grey with close-set grey spots which are aligned in vertical bands, interspersed with yellow, on the upper sides and form horizontal rows on the lower sides. The dorsal fin has a yellow margin and there is a bright orange patch running through the caudal peduncle.[1]

It is found in coral-rich areas and clear waters of seaward and lagoon reefs. This fish feeds on filamentous algae and coral polyps and other benthic invertebrates.[1]

Footnotes

  1. ^ a b c FishBase [2008]
  2. ^ Fessler & Westneat (2007), Hsu et al. (2007)

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!