Overview

Comprehensive Description

Biology

Occur in lagoon and seaward reefs in areas with rich coral growth (Ref. 1602). Juveniles may be found in shallow Acropora thickets (Ref. 1602). Adults occur in pairs (Ref. 1602, 48636). Omnivorous. Feed on coral polyps (Ref. 37816). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205). This species is extremely difficult to maintain in an aquarium and is very rarely imported.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Pitcairn Group, north to Japan, south to Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is distributed throughout the Indian Ocean and western and southern Pacific Ocean. It has been recorded from the coast of East Africa and Madagascar in the west to the Mangarava (French Polynesia) in the east. It is found as far north as southern Japan (Kashiwa-jima), ranging south to Lord Howe Island (Australia) and Rapa Iti (G.R. Allen pers. comm. 2006). Found at depths of 5-30 m.Range size ~66 million km2, from values estimated by Jones et al. (2002) based on projection of distribution maps from Allen et al. (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Madagascar, Mauritius, Mozambique, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 14 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 5372))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body yellow and large black blotch with blue circle on sides (Ref. 48636). Juveniles appear to be very similar in coloration to the adults except for the white outline of the black spot which disappears as the fish increases in size.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in lagoon and seaward reefs in areas of rich coral growth (Ref. 1602). Juveniles may be found in shallow @Acropora@ thickets (Ref. 1602). Adults occur in pairs at depths of 5 to 30 m (Ref. 1602). Omnivorous. This species is extremely difficult to maintain in an aquarium and is very rarely imported.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 30 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Generally found in lagoons and outer reefs where coral growth is prolific (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). Juveniles most often seen in shallower water among branching corals belonging to the genus Acropora. Individuals have very large home ranges. While detailed feeding observations have not been completed, this species is an obligate corallivore.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 20 specimens in 1 taxon.
Water temperature and chemistry ranges based on 19 samples.

Environmental ranges
  Depth range (m): 2.135 - 53
  Temperature range (°C): 25.709 - 29.037
  Nitrate (umol/L): 0.050 - 1.251
  Salinity (PPS): 34.131 - 35.312
  Oxygen (ml/l): 4.438 - 4.727
  Phosphate (umol/l): 0.100 - 0.214
  Silicate (umol/l): 1.089 - 4.407

Graphical representation

Depth range (m): 2.135 - 53

Temperature range (°C): 25.709 - 29.037

Nitrate (umol/L): 0.050 - 1.251

Salinity (PPS): 34.131 - 35.312

Oxygen (ml/l): 4.438 - 4.727

Phosphate (umol/l): 0.100 - 0.214

Silicate (umol/l): 1.089 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Archer butterflyfish. Attains 20 cm. Feeds mainly on coral polyps and hence difficult to keep in an aquarium. Often seen in pairs on outer reefs between 5 and 20 metres. Tropical Indo-West Pacific from Delagoa Bay to Japan and central Pacific. Seen at Sodwana in May 2007 - has paired up with a Chaetodon zanzibarensis. Neville Ayliffe has seen them many times together during 2006 and 2007. Occurs in lagoon and seaward reefs in areas with rich coral growth . Juveniles may be found in shallow Acropora thickets. Adults occur in pairs. Omnivorous. This species is extremely difficult to maintain in an aquarium and is very rarely sold.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodon bennetti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTTGGTGCTTGAGCTGGAATAGTGGGCACTGCCTTAAGTCTGCTTATCCGAGCAGAGCTCAGCCAACCAGGCACTCTCCTAGGGGACGATCAAATCTATAANGTAATTGTTACGGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGGAACTGACTAATTCCTCTAATGATTGGGGCCCCTGATATGGCCTTCCCTCGAANAAATAACATGAGCTTTTGGCTTCTACCCCCTTCCTTCTTCCTACTGCTCGCCTCTTCCGGCGTAGAATCCGGAGCTGGCACAGGCTGAACAGTCTACCCCCCGCTGGCTAGTAATTTAGCACACGCCGGGGCATCCGTCGATTTAACCATTTTCTCCCTTCACCTCGCAGGGGTTTCCTCCATCCTTGGGGCCATTAATTTCATTACAACAATCCTCAACATGAAACCCCCCGCTATGTCTCAGTACCAAACCCCCCTCTTCGTATGGTCCGTTTTAATTACAGCCGTCCTTCTTCTCCTATCCCTCCCTGTCCTTGCGGCTGGCATTACAATACTCCTCACAGACCGGAACCTAAACACAACTTTCTTTGACCCTGCAGGAGGAGGTGACCCTATTCTATATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodon bennetti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Chaetodon bennetti feeds exclusively on live coral, making it susceptible to extensive coral loss. This species is naturally low in abundance and therefore it cannot be reliably surveyed using normal sampling protocols, so it is unknown whether there have been significant declines in abundance at sites where there has been extensive coral depletion. It is possible that slight declines in abundance will make local populations no longer viable. It is listed as Data Deficient. Research is recommended on the ecology and natural history of the species. Monitoring of populations is also required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

This is an uncommon species, occurring in low abundance throughout its range (e.g., mean of 0.03 individuals per 200 m2 in Moorea, French Polynesia; Berumen and Pratchett 2006). This species is likely to decline in abundance following coral loss, but it is too rare to reliably sample using standard survey techniques. However, it is widespread and the global population is potentially large. It is usually observed as solitary individuals, but sometimes in pairs (G.R. Allen pers. comm. 2006).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

This species relies on live coral for food and/or recruitment, and may therefore decline in abundance following climate-induced coral depletion (Pratchett et al. 2008). Currently, there have been no documented declines associated with coral loss, and there appear to be no other major threats to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within marine protected areas. Monitoring of this species is needed in conjunction with coral monitoring, though it will require specific sampling methods to reliably estimate its abundance. Research is required to establish its specific dietary requirements and reliance on coral.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bluelashed butterflyfish

The bluelashed butterflyfish, Chaetodon bennetti, is a species of butterflyfish (family Chaetodontidae). It is found in the Indo-Pacific from East Africa to the Pitcairn Islands, north to Japan and south to Lord Howe Island and Rapa Iti.[1]

It grows to a maximum of 20 cm (almost 8 in) long. The body is yellow with a black patch surrounded by a blue circle below the dorsal fin and two curved blue lines above the belly. Its vertical black eyestripe is flanked by two blue lines.[1]

Like the other butterflyfishes with angular yellow bodíes with black eyestripes and (except in the present species) a single differently-colored patch, it belongs in the subgenus Tetrachaetodon. Among this group it seems to be the most basal living species. If Chaetodon is split up, this subgenus would be placed in Megaprotodon.[2]

The bluelashed butterflyfish is found in seaward and lagoon reefs in areas with rich coral growth. Juveniles may be found in shallow Acropora thickets. Adults occur in pairs. This species feeds largely on coral polyps.[1]

Footnotes

  1. ^ a b c FishBase (2008)
  2. ^ Fessler & Westneat (2007), Hsu et al. (2007)

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!