Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: butterflyfish (English), mariposa (Espanol)
 
Chaetodon auriga Forsskål, 1775

Threadfin butterflyfish

Body a strongly compressed oval disc; mouth small, at end of a short, pointed snout that is 2x eye diameter; teeth long and slender; dorsal fin with XIII, 22-25, front soft rays elongated into a filament; anal fin III, 19-21, 2nd  spine longer than 3rd; rear edges of dorsal and anal fins bluntly angular; tail edge straight to rounded; scales rough, covering dorsal and anal fins as well as head and body; lateral line in a high arch, incomplete (ends under dorsal fin); 33-43 lateral line scales.


Head and front ½ of body white; rear half of body, tail and rear parts of dorsal and anal fins yellow; a black bar from eye down; thin dark lines forming chevron pattern on body; a large black spot on upper soft dorsal.


Size: 23 cm.

Habitat: rocky and coral reefs.

Depth: 1-30 m.

An Indo-Pacific species; as a vagrant in the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

May be seen in a variety of habitats ranging from rich coral reefs (Ref. 58652) to weedy and rubble covered areas (Ref. 1602). Benthopelagic (Ref. 58302). Maybe found singly, in pairs, and in aggregations that roam over large distances in search of food. Feed mainly by tearing pieces from polychaetes, sea anemones, coral polyps, and algae (Ref. 1602). Oviparous (Ref. 205). Form pairs during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is distributed throughout the entire tropical Indo-Pacific region. It is found from the Red Sea and East Africa in the west to the Hawaiian Islands (USA), Marquesas Islands (French Polynesia) and Ducie Atoll (Pitcairn Islands, UK) in the east. It is found in the north from southern Japan and south to south eastern and western Australia including Lord Howe Island (Australia) and Rapa (G.R. Allen pers. comm. 2006). Vagrants are occasionally seen in the eastern Pacific at the Galapagos Islands (Ecuador). It has been recorded at depths of one to 61 m.
Range size ~82.2 million km2, from values estimated by Jones et al. (2002) based on projection of distribution maps from Allen et al. (1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (extending to Mossel Bay, South Africa, Ref. 5372) to the Hawaiian, Marquesan, and Ducie islands, north to southern Japan, south to Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Threadfin butterflyfish are found throughout the Indian and Pacific Oceans. They are found in the Red Sea and the coast of eastern Africa, off the coasts of Australia and New Guinea, east to the Hawaiian, Marquesan, and Ducie islands, as far north as southern Japan, and south to the Lord Howe and Rapa islands.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands, northern Line Islands and Pitcairn Group, north to southern Japan, south to Western Australia, New South Wales (Australia), Lord Howe Island and Ker
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 30 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 22 - 25; Analspines: 3; Analsoft rays: 19 - 21
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Threadfin butterflyfish are small, boldy colored fish (Findley and Findley 1985). They have a dark band running across the eye from the top of the head to the jaw, and a dark eyespot on the posterior part of the body (Nelson 1984). They have black lines and a yellow coloration on the posterior part of the body. They have broad, laterally compressed bodies and elongated snouts with small, sharp teeth (Moyle and Cech 2000). Adults can reach up to 23 cm (Steene 1977). Although young have patterns similar to adults, adults have a long filament extending from their dorsal fin (Steene 1977).

Range length: 23 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Findley, J., M. Findley. 1985. A search for pattern in butterfly fish communities. American naturalist, 126/6: 800-816.
  • Moyle, P., J. Cech. 2000. Fishes: an introduction to ichthyology. New Jersey: Prentice Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 23.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 230 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 4859))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

This species may be seen in a variety of habitats ranging from rich coral reefs to weed and rubble covered areas. It is found singly, in pairs, and in aggregations that roam over large distances in search of food. Feeds mainly by tearing pieces from polychaetes, sea anemones, coral polyps, and algae (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There is a pattern of `chevron' markings on the sides and a prominent black spot at the posterior edge of the soft portion of the dorsal fin. Adults of this species have a prominent black vertical band running across the eye, and a filament trailing posteriorly from the upper soft portion of the dorsal fin. Juveniles with a black bar over the head that hides the eye and an eye-sized black spot on the soft dorsal fin (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits a wide variety of coral reef habitat, and can be encountered in coastal, lagoonal, and outer reefs (G.R. Allen pers. comm. 2006). It feeds mainly by tearing pieces from polychaetes, sea anemones, coral polyps, and algae (Myers 1991). It may be found singly, in pairs and in aggregations. This species only very rarely consumes coral on the Great Barrier Reef (Pratchett 2005), but consumes mainly live corals in the Indian Ocean (Graham et al. 2006). It declined significantly in Moorea between 1979 and 2003, following shifts in coral community structure (Berumen and Pratchett 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 35 m (Ref. 11441)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threadfin butterflyfish are found in tropical coral reef habitats (Nelson 1984; Herald 1975; Jobling 1907). Although they are usually found where there is abundant coral, they are occasionally found in areas with sparse coral as well (Steene 1977). Chaetodon auriga are found at water depths between 1 and 35 meters (Capuli, 2006).

Range depth: 1 to 35 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

  • Jobling, M. 1995. Environmental biology of fishes. London, New York: Chapman & Hall.
  • Herald, E. 1962. Living fishes of the world. Garden City, N.Y.: Doubleday.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 179 specimens in 1 taxon.
Water temperature and chemistry ranges based on 155 samples.

Environmental ranges
  Depth range (m): 0.2 - 62
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.043 - 2.714
  Salinity (PPS): 33.950 - 36.148
  Oxygen (ml/l): 4.406 - 5.079
  Phosphate (umol/l): 0.055 - 0.507
  Silicate (umol/l): 0.567 - 4.776

Graphical representation

Depth range (m): 0.2 - 62

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.043 - 2.714

Salinity (PPS): 33.950 - 36.148

Oxygen (ml/l): 4.406 - 5.079

Phosphate (umol/l): 0.055 - 0.507

Silicate (umol/l): 0.567 - 4.776
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Threadfin butterfly. Attains 20 cm.  This species may be seen in a variety of habitats ranging from rich coral reefs to weedy and rubble covered areas. It is found singly, in pairs, and in aggregations that roam over large distances in search of food. Feeds mainly by tearing pieces from polychaetes, sea anemones, coral polyps, and algae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Macroalgae, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occur inshore (Ref. 75154). Also found in groups or in pairs (Ref. 4859).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Chaetodon auriga are benthic feeding fish that feed mostly on plankton (Pratchett 2001). However, they are omnivorous, and also feed on coral polyps, algae, shrimp, gastropods, nemertime worms, and polychaetes (Steene 1977). Threadfin butterflyfish have elongated snouts, with small protractile mouths that are filled with many small, sharp teeth (Moyle and Cech 2000; Herald, 1962 Jordan, 1907). They are able to use their elongated snouts in order to scrape the surface of coral to obtain algae and other small prey (Moyle and Cech 2000).

Animal Foods: mollusks; aquatic or marine worms; aquatic crustaceans; cnidarians; zooplankton

Plant Foods: algae; phytoplankton

Primary Diet: omnivore

  • Pratchett, M., N. Gust, G. Goby, S. Klanten. 2001. Consumption of coral propagules represents a significant trophic link between corals and reef fish. Coral Reefs, 20: 13-17.
  • Jordan, D. 1907. Fishes. New York: Holt and Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Omnivore

Diet: benthic microalgae, sponges/seasquirts/bryozoa, soft corals/hydroids, hard corals, sessile worms, sessile molluscs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Butterflyfish are dependent on coral reefs to obtain much of their food. The number of butterflyfish in an area is largely dependent on the amount of coral in a particular reef ecosystem (Ohman et al. 1998). In addition, butterflyfish are important in reducing the amount of algae that accumulates on coral (Moyle and Cech 2000). Butterflyfish and their eggs and larvae are important food items for marine predators.

  • Ohman, M., A. Rajasuriya, S. Svensson. 1998. The use of butterflyfishes (Chaetodontidae) as bio-indicators of habitat structure and human disturbance. AMBIO, 27/8: 708-716.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There are few documented predators of threadfin butterflyfish (Jordan 1907). Their spiny fins and quick speed make them difficult prey (Norman 1975; Jordan, 1907). Threadfin butterflyfish have mechanisms in order to deter and avoid potential predators. The dark bands over their eyes, as well as the posterior eyespot are probably mechanisms to confuse potential predators, making their tails seem to be their head and their head seem to be a tail (Nelson 1984). Other butterflyfish species have been reported swimming short distances tail first, and then rapidly swimming off in the opposite direction in order to confuse and escape potential predators (Norman 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Uronema infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hurleytrematoides Infestation 7. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Threadfin butterflyfish are visual predators, and they use their appearance to fool potential predators. Little additional information is available on how they communicate with one another (Nelson 1984).

Communication Channels: visual

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Butterflyfish release eggs into the water column, which are externally fertilized (Hourigan 1989). Embryos hatch approximately 30 days after spawning and the larvae then spend about 40 days floating in the water column as plankton before they metamorphose into juveniles (Hourigan 1989).

Development - Life Cycle: metamorphosis

  • Hourigan, T. 1989. Environmental Determinants of Butterflyfish social systems. Environmental Biology of Fishes, 25/1-3: 61-78.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information known about the lifespan of butterflyfish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Chaetodon auriga are monogamous, they mate with one partner and maintain this partnership for many years (Jobling 1995; Paxton and Eschmeyer 1998; Roberts and Ormond 1992). Low rates of adult mortality enable these monogamous relationships to last for many breeding seasons. However, if an individual loses a mate, they will find another (Roberts and Ormond 1992; Hourigan 1989)

Mating System: monogamous

Female C. auriga release hundreds of thousands of eggs at a time (Hourigan 1989). Threadfin butterflyfish spawn frequently throughout their long breeding seasons (Roberts and Ormond 1992). They can be sexually mature at sizes of 13 cm (Capuli, 2006).

Breeding interval: Threadfin butterflyfish breed frequently. Factors influencing breeding frequency are not known.

Breeding season: Threadfin butterflyfish may breed throughout the year.

Average time to hatching: 30 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

There is little information available on parental investment of Chaetodon auriga, however other species of butterflyfish do not invest in parental care (Roberts and Ormond, 1992). Once the eggs are fertilized in the water column, there is no further parental involvement.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Jobling, M. 1995. Environmental biology of fishes. London, New York: Chapman & Hall.
  • Paxton, J., W. Eschmeyer. 1998. Encyclopedia of fishes. San Diego, California: Academic Press.
  • Roberts, C., R. Ormond. 1992. Butterflyfish social-behavior, with special reference to the incidence of territoriality-a review. Environmental Biology of Fishes, 34/1: 79-93.
  • Hourigan, T. 1989. Environmental Determinants of Butterflyfish social systems. Environmental Biology of Fishes, 25/1-3: 61-78.
  • Capuli, E. 2006. "Chaetodon auriga, Threadfin butterflyfish" (On-line). Fishbase. Accessed November 20, 2006 at http://www.fishbase.org/Summary/speciesSummary.php?ID=5557&genusname=Chaetodon&speciesname=auriga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaetodon auriga

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chaetodon auriga

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGGATAGTAGGTACTGCCCTAAGTCTGCTCATTCGGGCAGAGCTCAGCCAACCAGGCTCCCTCCTGGGCGACGACCAGATCTATAACGTAATTGTTACAGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGAAACTGACTGATTCCTCTAATGATTGGAGCCCCAGATATAGCCTTCCCTCGGATAAATAACATGAGCTTTTGGCTCCTGCCCCCCTCCTTTTTCCTACTCCTTGCCTCTTCTGGCGTAGAGTCCGGGGCTGGTACTGGATGAACGGTTTATCCCCCACTAGCTGGCAACCTAGCACACGCCGGAGCATCCGTCGATCTAACCATCTTCTCCCTTCACCTCGCAGGAGTTTCCTCCATCCTTGGGGCAATTAACTTCATCACAACAATTCTTAACATGAAACCCCCTGCCATATCTCAGTACCAGACCCCTCTTTTCGTGTGATCTGTTTTAATTACAGCCGTCCTGCTTCTCCTATCCCTGCCCGTTCTTGCAGCTGGGATTACAATACTCCTTACAGATCGAAACCTCAATACAACCTTTTTCGACCCCGCAGGAGGAGGCGACCCTATCCTGTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Myers, R. & Pratchett, M.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
There have been declines in the abundance of C. auriga in some areas and research is required to understand apparent reliance on live corals. It is collected for the aquarium trade but the impacts are unknown. Given that this species is very widespread and typically abundant, it is unlikely that localized declines have substantially affected the global population. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chaetodon auriga is not threatened at this time. However, it is believed that the density of butterflyfish correlates with the amount of live coral in a particular region. If reef habitats are destroyed, this will threaten butterflyfish populations (Ohman et al. 1998).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

This species is generally common (e.g., mean of 0.7 individuals per 20 0m2 in northern Great Barrier Reef; Pratchett and Berumen 2008). It has however, exhibited significant declines in abundance on the Great Barrier Reef (Pratchett 2001) and in French Polynesia (Berumen and Pratchett 2006) following extensive coral loss.




Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

While declines in abundance of C. auriga have been observed following localized coral loss, it is unknown why this species should have any reliance on live corals. It neither feeds or recruits on live coral (Pratchett et al. 2008). This species is collected for the aquarium trade however there is no data on how this affects the population. This species is harvested by artisanal fishers, accounting for 72% of the butterflyfishes caught (Mangi and Roberts 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation measures in place for Chaetodon auriga. This species is present within marine protected areas. Ongoing monitoring of catches by aquarium collectors is required. Research is required to confirm or understand the apparent reliance on live corals for this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Chaetodon auriga are not known to negatively affect humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

It may be possible to use butterflyfish, such as threadfin butterflyfish as bio-indicators in order to monitor coral reef ecosystems (Brokovich and Baranes 2005; Ohman 1998). Chaetodon auriga are also kept in aquaria as pets.

Positive Impacts: pet trade ; research and education

  • Brokovich, E., A. Baranes. 2005. Community structure and ecology of butterflyfishes (Chaetodontidae) in the Gulf of Aqaba (northern Red Sea). Aquatic Conservation: Marine and Freshwater Ecosystems, 15: S45-S58.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Threadfin butterflyfish

The threadfin butterflyfish, Chaetodon auriga, is a species of butterflyfish (family Chaetodontidae).

Contents

Distribution

Chaetodon auriga is found in the Indo-Pacific region, from the Red Sea and eastern Africa (south to Mossel Bay, South Africa) to the Hawaiian, Marquesas and Ducie islands, north to southern Japan, south to Lord Howe Island and Rapa Iti, at depths of 1–35 metres (3–115 ft).[2]

Description

Chaetodon auriga is up to 23 centimetres (9 in) long. It has a neck patch of ascending and a belly patch of descending oblique dark lines. Two subspecies are sometimes recognised: Chaetodon auriga auriga occurs in the Red Sea population and lacks the dorsal eyespot; Chaetodon auriga setifer is the spotted population occurring outside the Red Sea.[2]

Taxonomy

It belongs to the large subgenus Rabdophorus which might warrant recognition as a distinct genus. Within this group, it isalmost certainly a rather close relative of the vagabond butterflyfish (C. vagabundus) and the Indian vagabond butterflyfish (C. decussatus). The C. auriga species group shares the characteristic pattern of two areas of ascending and descending oblique lines; species differ conspicuously in hindpart coloration.[3][4]

References

  1. ^ R. Myers & M. Pratchett (2010). "Chaetodon auriga". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/165631. Retrieved October 27, 2012.
  2. ^ a b G. R. Allen. "Chaetodon auriga". In Rainer Froese & D. Pauly. FishBase. http://www.fishbase.org/Summary/SpeciesSummary.php?id=5557. Retrieved October 27, 2012.
  3. ^ Jennifer L. Fessler & Mark W. Westneat (2007). "Molecular phylogenetics of the butterflyfishes (Chaetodontidae): taxonomy and biogeography of a global coral reef fish family". Molecular Phylogenetics and Evolution 45 (1): 50–68. doi:10.1016/j.ympev.2007.05.018. PMID 17625921.
  4. ^ Kui-Ching Hsu, Jeng-Ping Chen & Kwang-Tsao Shao (2007). "Molecular phylogeny of Chaetodon (Teleostei: Chaetodontidae) in the Indo-West Pacific: evolution in geminate species pairs and species groups" (PDF). Raffles Bulletin of Zoology Suppl. 14: 77–86. http://rmbr.nus.edu.sg/rbz/biblio/s14/s14rbz10_Hsu-pp77-86.pdf.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!