Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

The porcupinefish mostly spends it time alone in caves or underneath corals during the day, or swimming around the reef and hunting for food by night. It will only be found with another porcupinefish when it is mating. Then, a male and female can be found together, or a group of males with a single female.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

  Common names: porcupinefish (English), pez erizo (Espanol)
 
Diodon hystrix Linnaeus, 1758


Spot-fin porcupinefish


Body robust, inflatable; head wide and blunt; no barbells on chin; eyes large; nasal organ a tentacle with 2 openings; teeth fused into a strong, parrot-like beak that lacks a front groove, large, opens widely at front; gill opening a vertical slit before pectoral base; pectorals large; fins without spines; no pelvic fins; dorsal 14-17; anal rays 14-16; pectoral rays 21-25; body and head covered with numerous long (> eye), erectible, 2-rooted, slender, round spines; 16-20 erectile spines in an approximate row from top of snout to dorsal fin; spines anteriorly at front of head shorter than longest spines posterior to pectoral fins; one or more small spines dorsally on tail base.

Light grey brown dorsally shading to white ventrally;  upper body and dorsal, anal and tail fins with small black spots.


Maximum length: 91 cm.

Adults inhabits coral or rocky reefs, juveniles occur in estuaries in our region.

Depth: 1-135 m.

Circumtropical distribution; southern California to the lower Gulf of California to Chile and all the oceanic islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Occur in lagoon and seaward reefs to at least 50 m. Commonly seen in caves and holes in shallow reefs (Ref. 26938, 48637). Juveniles to about 20 cm are pelagic. Adults benthic (Ref. 30573). Solitary and nocturnal that feed on hard shelled invertebrates like sea urchins, gastropods, and hermit crabs (Ref. 9680). Generally common (Ref. 9710). Not normally used as food (Ref. 3717). Reached a life-span of 10 years and a length of 69 cm in the McGinty Aquarium (E. Dashiell, pers. comm 2004), suggesting a preliminary K=0.12.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Fun Facts

Whereas most creatures drink water because they are thirsty, the porcupinefish gulps it down to protect itself from predators! When it feels threatened, it will take big swigs of water, which makes its body puff out like a balloon. After it has doubled or even tripled in size, with its spiky spines pointing outwards, most predators think twice about eating it.

As if that weren’t enough, the porcupinefish is also poisonous. Its skin and organs have a toxic chemical in them, made by bacteria that it eats. It will make other fish and people very sick if they eat it.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Spot-fin porcupinefish are found in the Pacific Ocean from San Diego, California to Chile, including the Hawaiian and Galapagos Islands, and the western Atlantic Ocean from Massachusetts to the northern Gulf of Mexico, as well as Bermuda, the Caribbean, and Brazil. They are also found around the Azorean and Seychelles Islands, as well as in the western Indian Ocean, off the coast of Kenya, Mozambique, Somalia and South Africa. Additionally, these fish can be found in the Mediterranean and Red Seas and off the coast of New Zealand.

Biogeographic Regions: nearctic (Native ); ethiopian (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumtropical. Eastern Pacific: San Diego, California, USA to Chile, including the Galapagos Islands (Ref. 37955). Western Atlantic: Bermuda, Massachusetts (USA), and northern Gulf of Mexico to Brazil (Ref. 7251). Eastern Atlantic: 30°N to 23°S (Ref. 6951). Western Indian Ocean: Red Sea to Madagascar, Reunion and Mauritius (Ref. 33390). The reports in the Mediterranean Sea are doubtful (Ref. 50345).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Worldwide in warm waters; north to Massachusetts and Bermuda in western Atlantic (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda, Massachusetts (USA), and northern Gulf of Mexico to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal in tropical and subtropical seas (including Red Sea, Seychelles, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 135 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Spot-fin porcupinefish have round, expandable, slender bodies with small fins. These fish lack pelvic fins, and the rounded dorsal and anal fins are positioned near the caudal fin. They have 22-25 pectoral fin rays, 14-17 dorsal fin rays, and 14-16 anal fin rays. They are covered in long spines, which lie flat along their bodies when they are not inflated, including a longitudinal row of spines (14-20) between their snouts and dorsal fins, as well as small spines covering their caudal peduncle area. Body color varies, but they are generally uniformly dull brown to green with the body covered in small dark spots and markings, with a pale belly that is surrounded by a dusky ring. Their fins do not have spots. These fish have large eyes and wide, flattened mouths. Their teeth are fused together and they have very strong jaws. Spot-fin porcupinefish can grow up to 91 cm, with an average of 40 cm, and have a maximum recorded weight of 2.8 kg. There are slight differences in body shape and color between males and females.

Range mass: 2.8 (high) kg.

Range length: 40 to 91 mm.

Other Physical Features: ectothermic ; bilateral symmetry ; poisonous

Sexual Dimorphism: sexes colored or patterned differently

  • Debelius, H., H. Hauser, J. Hoover. 2006. "Explorer's Guide - PorcupineFish" (On-line). Shedd Aquarium. Accessed September 25, 2012 at http://sea.sheddaquarium.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 14 - 17; Analspines: 0; Analsoft rays: 14 - 16
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 91.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 2,800 g (Ref. 40637)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in lagoon and seaward reefs to at least 50 m. Juveniles pelagic to about 20 cm . A solitary and nocturnal fish that feeds on hard shelled invertebrates like sea urchin, gastropods, and hermit crabs (Ref. 9680). Generally common (Ref. 9710).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body robust; teeth united in each jaw but without a central division; body covered with long, sharp spines, folded backwards when body not inflated; 16 to 20 spines between snout and dorsal fin; dorsal region of caudal peduncle spiny; back, flanks and fins light brown with numerous dark spots; belly spiny (Ref. 55763). Spines long. Body grayish tan, with small black spots, but no large dark blotches. Belly white, surrounded by dusky ring (Ref. 26938). About 20 spines in an approximate row between snout and dorsal fin (Ref. 13442).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Diodon hystrix
Catalog Number: USNM 50854
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Locality: No Data. Indo-Pacific
  • Type: Jenkins, O. P. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 488, fig. 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Adults are generally found in holes and crevices in inshore areas including lagoons, caves, shipwrecks, reefs, and ledges, and are also found in seamount areas. They are found at depths up to 50 meters, most commonly between 3 and 20 meters. Juveniles are pelagic until reaching 20 cm in length, becoming benthic thereafter.

Range depth: 1 to 50 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; reef ; coastal

  • Great Neck Publishing. 2006. Encyclopedia of Animals. Toledo, Ohio: Great Neck Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 50 m (Ref. 9680), usually 3 - 20 m (Ref. 40849)
  • Gasparini, J.L. and S.R. Floeter 2001 The shore fishes of Trindade Island, western South Atlantic. J. Nat. Hist. 35:1639-1656. (Ref. 40849)
  • Leis, J.M. 2001 Diodontidae. Porcupine fishes (burrfishes). p. 3958-3965. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9680)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 0 - 710
  Temperature range (°C): 6.257 - 29.336
  Nitrate (umol/L): 0.099 - 39.739
  Salinity (PPS): 34.131 - 36.315
  Oxygen (ml/l): 0.540 - 4.889
  Phosphate (umol/l): 0.092 - 2.927
  Silicate (umol/l): 0.921 - 46.771

Graphical representation

Depth range (m): 0 - 710

Temperature range (°C): 6.257 - 29.336

Nitrate (umol/L): 0.099 - 39.739

Salinity (PPS): 34.131 - 36.315

Oxygen (ml/l): 0.540 - 4.889

Phosphate (umol/l): 0.092 - 2.927

Silicate (umol/l): 0.921 - 46.771
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 50m.
From 2 to 50 meters.

Habitat: reef-associated. Occurs in lagoon and seaward reefs to at least 50 m. Juveniles pelagic to about 20 cm. A solitary and nocturnal fish that feeds on hard shelled invertebrates like sea urchin, gastropods, and hermit crabs (Ref. 9680). Generally common (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Estuary

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Spot-fin porcupinefish are durophagous and carnivorous, having strong jaws and teeth that are fused together, specializations for eating hard-shelled creatures. Their beaked mouths can catch and crush sea urchins, crabs, snails, and clams while their large, rubbery lips protect them from being injured by spines and broken shells. These fish commonly scavenge and search for prey in sandy areas, crevices, and caves.

Animal Foods: mollusks; aquatic or marine worms; aquatic crustaceans; echinoderms; other marine invertebrates

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in lagoon and seaward reefs to at least 50 m. Commonly seen in caves and holes in shallow reefs (Ref. 26938, 48637, 58534). Juveniles to about 20 cm are pelagic. Adults benthic (Ref. 30573). A solitary and nocturnal fish that feeds on hard shelled invertebrates like sea urchins, gastropods, and hermit crabs (Ref. 9680). Mobile-invertebrate feeder (Ref. 57615, 57616).
  • Randall, J.E. 1985 Guide to Hawaiian reef fishes. Harrowood Books, Newtown Square, PA 19073, USA. 74 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins, sessile crustacea, sessile worms, sessile molluscs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Spot-fin porcupinefish are an intermediate link in the reef food chain, serving both as nonspecific predators of benthic invertebrates and as prey for higher order predators. Like other fish, this species is host to numerous endo and ectoparasites.

Commensal/Parasitic Species:

  • Balakrishnan, K. 1969. Observations on the occurance of Choncoderma virgatum (Spengler) (Cirripedia) on Diodon hystrix Linnaeus (Pisces). Crustaceana, 16/1: 101-103.
  • Quilichini, Y., J. Foata, J. Justine, R. Bray, B. Marchand. 2010. Ultrastructural study of the spermatozoon of Heterolebes maculosus (Digenea, Opistholebetidae), a parasite of the porcupinefish Diodon hystrix (Pisces, Teleostei). Parasitology International, 59(3): 427-434.
  • Radhakrishnan, S., N. Nair. 1981. Tetrochetus coryphaenae (Digenea: Accacoeliidae) infection of Diodon hystrix (Pisces: Diodontidae). Proceedings of the Indian National Science Academy, B47/1: 47-52. Accessed February 18, 2013 at http://www.dli.gov.in/rawdataupload/upload/insa/INSA_2/20005a0c_47.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spot-fin porcupinefish are well-known for their defensive ability to inflate their bodies by swallowing water, causing their spines to extend outwards and preventing most predators from swallowing them. They also secrete dermal toxins that are poisonous to many species. They do have some known predators, however, mainly large-bodied fishes.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Menu

The porcupinefish crunches and munches shrimps, crabs, and sea urchins with its hard, beak-like jaw. It will also snack on small fish. It only eats animals, so it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Lymphocystis Disease. Viral diseases
  • McCosker, J.E. and R.F. Nigrelli 1971 New records of lymphocystis disease in four eastern pacific fish species. J. Fish. Res. Board Can. 28:1809-1810. (Ref. 45642)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

As in other bony fishes, Spot-fin porcupinefish use their eyes to see, nares to sense dissolved chemicals, and a lateral line to detect vibrations and movement via changes in water pressure.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spot-fin porcupinefish eggs are buoyant, pelagic, spherical, and 1.9-2.1 mm in diameter. About five days after fertilization, eggs hatch and larvae, which average 2.6 mm in length, float in the open ocean near the surface. Hatchlings have large amounts of yolk still attached to them. Within two days after hatching, larvae have formed fully functional mouths and their eyes have become fully pigmented. Body coloration is mainly orange and they are more highly pigmented dorsally. Larvae maintain a thin shell until they have reached about 5 mm in length (at about 10 days old). At this time they metamorphose into spiny juveniles. Within 3 weeks, fins, fin rays, and teeth have formed. Juvenile spot-fin porcupinefish become olive to brown in color with dark spots on their ventral sides, camouflaging them in the mats of seaweed where they hide until moving inshore, usually when they reach at least 20 cm in length.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Porcupine fish are known to survive at least 10 years in captivity. Lifespan in the wild is unknown.

Range lifespan

Status: captivity:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

This species is a broadcast spawner; males and females mate promiscuously during spawning events. Although mating behavior has not been observed for this species, in captivity or in the wild, it has been observed for captive Diodon holocanthus, a closely related species. Breeding begins when water temperatures reach approximately 25°C, likely from May through August. Multiple males approach a female at a time, bringing her up to the surface of the water where, if she has ripe eggs, she will release them. All of the males (usually 4-5) contribute sperm.

Mating System: polygynandrous (promiscuous)

Spot-fin porcupinefish breed when water temperature reaches approximately 25°C, typically from May-August. It is unknown how many offspring are produced by these fish at a time or what their age at sexual maturity is. Eggs usually hatch within 2 days of fertilization.

Breeding interval: Spot-fin porcupinefish breed once a year.

Breeding season: Breeding season for this species is assumed to be May-August.

Average gestation period: 2 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

As this species is a broadcast spawner, there is no parental investment. Planktonic larvae develop independently in the water column.

Parental Investment: no parental involvement

  • Leis, J. 1977. Systematics and zoogeography of the Porcupinefishes (Diodon, Diodontaidae, Tetraodontiformes), with comments on egg and larval development. Fishery Bulletin, 76/3: 535-567. Accessed February 18, 2013 at http://fishbull.noaa.gov/76-3/leis.pdf.
  • Patton, C. 1999. "Education Biological Profiles: Porcupinefish" (On-line). Florida Museum of Natural History. Accessed September 25, 2012 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/Porcupine/Porcupine.htm.
  • Sakamoto, T., K. Suzuki. 1978. Spawning behavior and early life history of the porcupine puffer, Diodon holacanthus, in aquaria. Japanese Journal of Ichthyology, 24/4: 261-270.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diodon hystrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTTTATTTAGTATTCGGTGCCTGAGCCGGAATGGTTGGGACGGCGCTTAGCCTCCTGATCCGGGCCGAACTTAGTCAACCAGGGAGCCTCCTTGGAGACGACCAAATTTACAACGTCATTGTTACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGACTGGTACCGTTAATAATCGGCGCCCCTGACATGGCCTTCCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCTTCTTTCCTCCTTCTCCTCGCCTCTTCAGGGGTAGAAGCCGGTGCCGGCACAGGATGGACAGTCTACCCGCCACTCGCAGGTAACCTCGCACATGCAGGGGCCTCCGTAGACCTGACTATCTTTTCTCTCCACCTCGCGGGAGTTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATCAACATAAAACCCCCCGCAATTTCCCAGTACCAAACCCCTCTTTTTGTCTGAGCTGTTCTAATCACTGCCGTCCTCTTACTTCTCTCCCTCCCAGTTCTTGCTGCAGGGATTACAATACTCCTCACCGACCGAAATCTCAACACCACCTTCTTTGACCCATCACGGGGCGGCCACCCCATCCTTTATCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Diodon hystrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Spot-fin porcupine fish are not considered endangered or vulnerable to extinction, according to the World Conservation Union. However, information is lacking about their natural history in their oceanic environment.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Threats

Some people will catch the porcupinefish when it is puffed-up to sell in souvenir shops. Not many people catch it for food, because it is poisonous, but some people do: in Japan, trained chefs will cut out most of its poison parts before it is served as a special dinner treat.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Except for occasional cases of fugu poisoning in Japan, there are no known adverse effects of these fish on humans.

Negative Impacts: injures humans (poisonous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is sold in the home aquarium trade. While the internal organs of this species are extremely toxic, it is customary in Japanese culture to eat the flesh of these fish as a type of sushi, called fugu. Spot-fin porcupinefish bodies are also made into souvenirs for tourists in tropical areas: after a porcupinefish is killed, it is inflated. It is then made into a lamp or wall display. Traditionally, the hardened bodies were also used as war helmets, by the Gilbertese people on the Gilbert Islands.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
  • Tyler, J.C. 1978 Diodontidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. Western Central Atlantic (Fishing Area 31). Vol. 2. [pag.var.]. FAO, Rome. (Ref. 3717)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spot-fin porcupinefish

The spot-fin porcupinefish (Diodon hystrix), also known as spotted porcupinefish, black-spotted porcupinefish or simply porcupinefish, is a member of the family Diodontidae.

Description[edit]

The spot-fin porcupinefish is a medium sized fish which grows up to 91 cm, but the average size mostly observed is 40 cm.[1] Its body is elongated with a spherical head with big round protruding eyes, a large mouth rarely closed. The pectoral fins are large, the pelvic fins are absent, the anal and dorsal fins are close to the caudal peduncle. The latter move simultaneously during swimming. The skin is smooth and firm, the scales are modified into spines. The body coloration is beige to sandy-yellow marbled with dark blotches and dotted with numerous small black spots.

In case of danger, the porcupinefish can inflate itself by swallowing water to deter the potential predator with its larger volume and it can raise its spines.

The porcupinefish concentrates a poison, called tetrodotoxin, in certain parts of its body such as the liver, skin, gonads and the viscera. Tetrodotoxin is a powerful neurotoxin. This defensive system constitutes an additional device to dissuade the potential predators.[2]

Distribution & habitat[edit]

The porcupinefish is found in all the tropical and subtropical waters of the world, including the Mediterranean Sea.[3]

Juveniles are pelagic up to the time that they are about 20 cm in length. Adults favour lagoons, top reefs and seaward coral or rocky reefs from one to 50 m depth, sheltering under ledges or in caves during the day.[4]

Feeding[edit]

The porcupinefish's diet is based on Sea urchins, gastropods and crustaceans.[5]

Behavior[edit]

This fish is solitary, except during mating periods, it has a nocturnal activity with a maximal activity at sunset and sunrise.

Parasites[edit]

Cysts of the trypanorhynch Molicola horridus in the liver of a porcupinefish

As most fish, the porcupinefish is infected by a variety of parasites. Spectacular parasites are the cysts of the larvae of the trypanorhynch cestode Molicola horridus, often found in great numbers in the liver.[6] These parasites are not appetizing, but represent no danger to humans.

References[edit]

  1. ^ http://www.fishbase.org/summary/1022
  2. ^ Grignard JC, Mitel C, in : DORIS, 2/9/2012: Diodon hystrix Linnaeus, 1758, http://doris.ffessm.fr/fiche2.asp?fiche_numero=2379
  3. ^ http://www.fishbase.org/summary/1022
  4. ^ http://www.fishbase.org/summary/1022
  5. ^ Leis, J.M., 2001. Diodontidae. Porcupine fishes (burrfishes). p. 3958-3965. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome.
  6. ^ Beveridge, I., Bray, R. A., Cribb, T. H. & Justine, J.-L. 2014: Diversity of trypanorhynch metacestodes in teleost fishes from coral reefs off eastern Australia and New Caledonia. Parasite, 21, 60. doi:10.1051/parasite/2014060 PubMed open access publication - free to read
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!