Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

The porcupinefish mostly spends it time alone in caves or underneath corals during the day, or swimming around the reef and hunting for food by night. It will only be found with another porcupinefish when it is mating. Then, a male and female can be found together, or a group of males with a single female.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Occur in lagoon and seaward reefs to at least 50 m. Commonly seen in caves and holes in shallow reefs (Ref. 26938, 48637). Juveniles to about 20 cm are pelagic. Adults benthic (Ref. 30573). Solitary and nocturnal that feed on hard shelled invertebrates like sea urchins, gastropods, and hermit crabs (Ref. 9680). Generally common (Ref. 9710). Not normally used as food (Ref. 3717). Reached a life-span of 10 years and a length of 69 cm in the McGinty Aquarium (E. Dashiell, pers. comm 2004), suggesting a preliminary K=0.12.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: porcupinefish (English), pez erizo (Espanol)
 
Diodon hystrix Linnaeus, 1758


Spot-fin porcupinefish


Body robust, inflatable; head wide and blunt; no barbells on chin; eyes large; nasal organ a tentacle with 2 openings; teeth fused into a strong, parrot-like beak that lacks a front groove, large, opens widely at front; gill opening a vertical slit before pectoral base; pectorals large; fins without spines; no pelvic fins; dorsal 14-17; anal rays 14-16; pectoral rays 21-25; body and head covered with numerous long (> eye), erectible, 2-rooted, slender, round spines; 16-20 erectile spines in an approximate row from top of snout to dorsal fin; spines anteriorly at front of head shorter than longest spines posterior to pectoral fins; one or more small spines dorsally on tail base.

Light grey brown dorsally shading to white ventrally;  upper body and dorsal, anal and tail fins with small black spots.


Maximum length: 91 cm.

Adults inhabits coral or rocky reefs, juveniles occur in estuaries in our region.

Depth: 1-135 m.

Circumtropical distribution; southern California to the lower Gulf of California to Chile and all the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Fun Facts

Whereas most creatures drink water because they are thirsty, the porcupinefish gulps it down to protect itself from predators! When it feels threatened, it will take big swigs of water, which makes its body puff out like a balloon. After it has doubled or even tripled in size, with its spiky spines pointing outwards, most predators think twice about eating it.

As if that weren’t enough, the porcupinefish is also poisonous. Its skin and organs have a toxic chemical in them, made by bacteria that it eats. It will make other fish and people very sick if they eat it.

Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Chagos, European waters (ERMS scope), Gulf of Mexico, Kenya, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumtropical. Eastern Pacific: San Diego, California, USA to Chile, including the Galapagos Islands (Ref. 37955). Western Atlantic: Bermuda, Massachusetts (USA), and northern Gulf of Mexico to Brazil (Ref. 7251). Eastern Atlantic: 30°N to 23°S (Ref. 6951). Western Indian Ocean: Red Sea to Madagascar, Reunion and Mauritius (Ref. 33390). Mediterranean (Ref. 50345).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Bermuda, Massachusetts (USA), and northern Gulf of Mexico to Brazil
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Worldwide in warm waters; north to Massachusetts and Bermuda in western Atlantic (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical and subtropical seas (including Red Sea, Seychelles, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 135 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 14 - 17; Analspines: 0; Analsoft rays: 14 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 91.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 2,800 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body robust; teeth united in each jaw but without a central division; body covered with long, sharp spines, folded backwards when body not inflated; 16 to 20 spines between snout and dorsal fin; dorsal region of caudal peduncle spiny; back, flanks and fins light brown with numerous dark spots; belly spiny (Ref. 55763). Spines long. Body grayish tan, with small black spots, but no large dark blotches. Belly white, surrounded by dusky ring (Ref. 26938). About 20 spines in an approximate row between snout and dorsal fin (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in lagoon and seaward reefs to at least 50 m. Juveniles pelagic to about 20 cm . A solitary and nocturnal fish that feeds on hard shelled invertebrates like sea urchin, gastropods, and hermit crabs (Ref. 9680). Generally common (Ref. 9710).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Diodon hystrix
Catalog Number: USNM 50854
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Locality: No Data. Indo-Pacific
  • Type: Jenkins, O. P. 1903. Bulletin of the United States Fish Commission. 22 (for 1902): 488, fig. 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 50 m (Ref. 9680), usually 3 - 20 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 21 samples.

Environmental ranges
  Depth range (m): 0 - 710
  Temperature range (°C): 6.257 - 29.336
  Nitrate (umol/L): 0.099 - 39.739
  Salinity (PPS): 34.131 - 36.315
  Oxygen (ml/l): 0.540 - 4.889
  Phosphate (umol/l): 0.092 - 2.927
  Silicate (umol/l): 0.921 - 46.771

Graphical representation

Depth range (m): 0 - 710

Temperature range (°C): 6.257 - 29.336

Nitrate (umol/L): 0.099 - 39.739

Salinity (PPS): 34.131 - 36.315

Oxygen (ml/l): 0.540 - 4.889

Phosphate (umol/l): 0.092 - 2.927

Silicate (umol/l): 0.921 - 46.771
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 50m.
From 2 to 50 meters.

Habitat: reef-associated. Occurs in lagoon and seaward reefs to at least 50 m. Juveniles pelagic to about 20 cm. A solitary and nocturnal fish that feeds on hard shelled invertebrates like sea urchin, gastropods, and hermit crabs (Ref. 9680). Generally common (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Estuary

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in lagoon and seaward reefs to at least 50 m. Commonly seen in caves and holes in shallow reefs (Ref. 26938, 48637, 58534). Juveniles to about 20 cm are pelagic. Adults benthic (Ref. 30573). A solitary and nocturnal fish that feeds on hard shelled invertebrates like sea urchins, gastropods, and hermit crabs (Ref. 9680). Mobile-invertebrate feeder (Ref. 57615, 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins, sessile crustacea, sessile worms, sessile molluscs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

WhyReef - Menu

The porcupinefish crunches and munches shrimps, crabs, and sea urchins with its hard, beak-like jaw. It will also snack on small fish. It only eats animals, so it is a carnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Lymphocystis Disease. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diodon hystrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTTTATTTAGTATTCGGTGCCTGAGCCGGAATGGTTGGGACGGCGCTTAGCCTCCTGATCCGGGCCGAACTTAGTCAACCAGGGAGCCTCCTTGGAGACGACCAAATTTACAACGTCATTGTTACGGCACACGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTTGGAAACTGACTGGTACCGTTAATAATCGGCGCCCCTGACATGGCCTTCCCTCGAATGAATAATATGAGCTTTTGACTTCTTCCCCCTTCTTTCCTCCTTCTCCTCGCCTCTTCAGGGGTAGAAGCCGGTGCCGGCACAGGATGGACAGTCTACCCGCCACTCGCAGGTAACCTCGCACATGCAGGGGCCTCCGTAGACCTGACTATCTTTTCTCTCCACCTCGCGGGAGTTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATCAACATAAAACCCCCCGCAATTTCCCAGTACCAAACCCCTCTTTTTGTCTGAGCTGTTCTAATCACTGCCGTCCTCTTACTTCTCTCCCTCCCAGTTCTTGCTGCAGGGATTACAATACTCCTCACCGACCGAAATCTCAACACCACCTTCTTTGACCCATCACGGGGCGGCCACCCCATCCTTTATCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diodon hystrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

WhyReef - Threats

Some people will catch the porcupinefish when it is puffed-up to sell in souvenir shops. Not many people catch it for food, because it is poisonous, but some people do: in Japan, trained chefs will cut out most of its poison parts before it is served as a special dinner treat.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spot-fin porcupinefish

Also known as the porcupinefish[1] or porcupine puffer.

Contents

Range

The spot-fin porcupinefish is circumtropical:[2]

Description

Diodon hystrix may be up to 91 cm long and weigh as much as 2.8 kg. It is coloured tan with dark spots above and pale below, and has many long, moveable spines. It is largely nocturnal.

Diet

Sea urchins, gastropods and hermit crabs.

Habitat

Juveniles are pelagic up to the time that they are about 20 cm in length. Adults favour lagoons and seaward reefs, sheltering under ledges or in caves during the day. Although classified as benthic, they may sometimes be found hovering high in the water.[1]

Hazards

Diodon hystrix are poisonous to eat, possibly due to the accumulation of tetrodotoxin.

In the Aquarium

Has been documented to achieve a life-span of 10 years and attain a length of 69 cm in a public aquarium.

References

  1. ^ a b Lieske, E. and Myers, R.F. (2004) Coral reef guide; Red Sea London, HarperCollins ISBN 0-00-715986-2
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2007). "diodon hystrix" in FishBase. 6 2007 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!