Diaphus theta — Details

White-spotted Lantern-fish learn more about names for this taxon

Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Learn more about this article

Epipelagic to mesopelagic (Ref. 31442). Feed at night or in the morning (Ref. 9199), on euphausiids, copepods, and amphipods (Ref. 11712). Oviparous, with planktonic eggs and larvae (Ref. 31442). Lipid content is 15.8 % in fresh body weight while wax ester is present in trace amounts (Ref. 9197). Minimum depth reported from Ref. 6885.

Clemens, W.A. and G.V. Wilby 1961 Fishes of the Pacific coast of Canada. 2nd ed. Fish. Res. Bd. Canada Bull. (68):443 p. (Ref. 4925) http://www.fishbase.org/references/FBRefSummary.php?id=4925&speccode=3813

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

North Pacific subarctic transition zone and California Current (Northeastern Pacific), waifs reaching Hawaiian Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific

Gillespie, G. E. 1993. An updated list of the fishes of British Columbia, and those of interest in adjacent waters, with numeric code designations. Can. Tech. Rep. Fish. Aquat. Sci. 1918: 116 p. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=155121
Hart, J.L., 1973. Pacific Fishes of Canada. Fish. Res. Bd. Can. Bull 180. 740 pages. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=147633

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Eastern Pacific: common in California Current region to 20°S (Ref. 31442), including Hawaii (Ref. 4925). Northwest Pacific: throughout subarctic-transitional waters to northern Japan (Ref. 31442).

Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442) http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

National Distribution

Learn more about this article

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 0; Dorsal soft rays (total): 12 - 14; Analspines: 0; Analsoft rays: 12 - 14; Vertebrae: 34 - 36

Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442) http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 114 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

11.4 cm TL (male/unsexed; (Ref. 4925))

Clemens, W.A. and G.V. Wilby 1961 Fishes of the Pacific coast of Canada. 2nd ed. Fish. Res. Bd. Canada Bull. (68):443 p. (Ref. 4925) http://www.fishbase.org/references/FBRefSummary.php?id=4925&speccode=3813

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Adipose small, narrow based, slender (Ref. 6885). Brown to black on dorsal surface, lighter ventrally; fins pale (Ref. 6885). Branchiostegal rays: 9 (Ref. 31442).

Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442) http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Type for Diaphus theta
Catalog Number: USNM 41914
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Eigenmann
Year Collected: 1889
Locality: Off Pt. Loma, San Diego, San Diego County, California, United States, Pacific

Type:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Type for Diaphus theta
Catalog Number: USNM 41922
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Eigenmann
Year Collected: 1889
Locality: Off Point Loma, San Diego, San Diego County, California, United States, Pacific

Type:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Type for Diaphus theta
Catalog Number: USNM 44290
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1889
Locality: Off Oregon and Washington, Washington, United States, Pacific
Depth (m): 1068 to 1068
Vessel: Albatross

Type:

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Learn more about this article

Depth: 10 - 1687m.
From 10 to 1687 meters.

Habitat: bathypelagic. Feeds on euphausiids, copepods, and amphipods (Ref. 11712). Feeds at night or in the morning (Ref. 9199). Lipid content is 15.8 % in fresh body weight while wax ester is present in trace amounts (Ref. 9197).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Environment

Learn more about this article

bathypelagic; marine; depth range 0 - 3400 m (Ref. 50550), usually 10 - 400 m (Ref. 28981)

Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550) http://www.fishbase.org/references/FBRefSummary.php?id=50550&speccode=4633
Shinohara, G., K. Yabe, M. Nakaya, G. Anma, S. Yamaguchi and K. Amaoka 1994 Deep-sea fishes collected from the North Pacific by the T/S Oshoro-Maru. Bull. Fac. Fish. Hokkaido Univ. 45 (2):48-80. (Ref. 28981) http://www.fishbase.org/references/FBRefSummary.php?id=28981&speccode=12541

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Known from seamounts and knolls

Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication. http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 76 samples.

Environmental ranges
  Depth range (m): 0 - 50000
  Temperature range (°C): 1.710 - 14.707
  Nitrate (umol/L): 0.430 - 44.812
  Salinity (PPS): 31.271 - 34.932
  Oxygen (ml/l): 0.401 - 6.493
  Phosphate (umol/l): 0.449 - 3.281
  Silicate (umol/l): 3.526 - 175.223

Graphical representation

Depth range (m): 0 - 50000

Temperature range (°C): 1.710 - 14.707

Nitrate (umol/L): 0.430 - 44.812

Salinity (PPS): 31.271 - 34.932

Oxygen (ml/l): 0.401 - 6.493

Phosphate (umol/l): 0.449 - 3.281

Silicate (umol/l): 3.526 - 175.223

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Oviparous (Ref. 31442).

Moser, H.G. and E.H. Ahlstrom 1996 Myctophidae: lanternfishes. p. 387-475. In H.G. Moser (ed.) The early stages of fishes in the California Current Region. California Cooperative Oceanic Fisheries Investigations (CalCOFI) Atlas No. 33. 1505 p. (Ref. 31442) http://www.fishbase.org/references/FBRefSummary.php?id=31442&speccode=50707

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diaphus theta

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 7 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AGATATTGGCACCCTCTATCTAGTATTTGGTGCCTGAGCAGGCATAGTAGGAACTGCTCTTAGCCTTCTTATCCGAGCTGAACTAAGTCAACCTGGCGCCCTCCTGGGGGATGATCAGATTTATAATGTAATTGTAACGGCCCACGCCTTCGTAATAATTTTCTTCATAGTAATACCCATCATGATTGGGGGCTTTGGGAACTGACTAATTCCCCTAATGATCGGTGCCCCCGACATGGCTTTCCCCCGAATAAACAACATGAGCTTCTGACTGCTTCCCCCCTCCTTCCTTCTCCTCCTAGCCTCATCTGGCGTAGAAGCCGGGGCTGGGACCGGGTGAACAGTTTACCCACCCCTTGCAGGCAACCTGGCCCACGCCGGTGCATCTGTTGATCTAACAATCTTCTCCCTTCACCTAGCAGGTGTCTCATCTATTCTAGGGGCTATCAACTTCATCACAACCATTATCAACATGAAACCCCCTGCGATCACCCAATACCAGACCCCTCTATTCGTATGGGCAGTTCTCATCACAGCCGTGCTTCTTCTTCTATCTCTCCCTGTCCTAGCTGCCGGCATTACAATGCTCTTGACAGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGGGGAGGAGACCCCATCCTTTACCAACACCTATTCTGATTCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Diaphus theta

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 12
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

National NatureServe Conservation Status

Learn more about this article

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

NatureServe Conservation Status

Learn more about this article

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!