Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An uncommon inhabitant of reefs; hides in deep crevices during the day and roams the reef at night (Ref. 9710). Benthopelagic (Ref. 58302). Feeds on small crustaceans, crustacean larvae, and small fishes (Ref. 9710). Solitary and seldom seen; cryptic (Ref 90102).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: soldierfish (English), candil (Espanol), soldado (Espanol)
 
Plectrypops lima (Valenciennes in Cuvier & Valenciennes, 1831)


Roughscale soldierfish,     Shy soldierfish


Body ovate, deep; snout moderately pointed with relatively long straight forehead; eyes large, at upper margin of head; mouth moderately large, slightly oblique; edge of bone under eye with small, slender, curved, partly forward-pointing spines; no large spines at corner of operculum or preoperculum; dorsal with XII spines , last spine shorter than spine before it, divided to base between 11th  and 12th  spines, dorsal spines relatively short, 14-16 soft rays; anal fin IV, 10-12, none of spines extremely long or thick; tail fin small, forked, with strongly rounded lobes; scales very rough; lateral-line scales 39-42.



Uniform bright red.


Size: grows to 16 cm.

Habitat: a seldom seen fish that hides in caves and crevices during the day.

Depth: 3-40 m.



Widespread in the tropical Indo-Pacific; known in the eastern Pacific from Cocos and Clipperton and the Revillagigedos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to Hawaii, north to southern Japan, south to Lord Howe Island. Eastern Pacific: Easter Island.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: South Africa and East Africa, Seychelles, Madagascar, Mauritius (Mascarenes) and Chagos Archipelago east to Cocos Island, Clipperton and Reviallagigedo Islands (Eastern Pacific), north to southern Japan and Ogasawara Islands, south to New Ca
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 3 (S) - 40 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 14 - 16; Analspines: 4; Analsoft rays: 10 - 12
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 16.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 160 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

16.0 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Scale coarsely ctenoid; no pair of tooth patches at front of lower jaw outside gape; color is uniform bright red (Ref. 2334).Description: Characterized by lack of large spine at corner of preopercle; depth of body about 2.4 in SL (Ref 90102).
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 40 m (Ref. 30874)
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 71 samples.

Environmental ranges
  Depth range (m): 2 - 55
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.019 - 2.498
  Salinity (PPS): 33.044 - 35.924
  Oxygen (ml/l): 4.387 - 5.079
  Phosphate (umol/l): 0.085 - 0.409
  Silicate (umol/l): 0.810 - 3.521

Graphical representation

Depth range (m): 2 - 55

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.019 - 2.498

Salinity (PPS): 33.044 - 35.924

Oxygen (ml/l): 4.387 - 5.079

Phosphate (umol/l): 0.085 - 0.409

Silicate (umol/l): 0.810 - 3.521
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 40m.
From 5 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Stays in reef crevices during daytime. After dark, solitary individuals are widespread in exposed positions, swimming close to the reef (Ref. 13550). Feeds on small crustaceans, crustacean larvae, and small fishes (Ref. 9710).
  • Hobson, E.S. 1974 Feeding relationships of teleostean fishes on coral reefs in Kona, Hawaii. Fish. Bull. 72(4):915-1031. (Ref. 13550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: Pelagic crustacea, zooplankton, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plectrypops lima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACTGCCCTAAGCCTCCTCATCCGAGCTGAATTAAGCCAACCTGGAGCCCTTCTGGGAGACGATCAAATCTACAACGTTATCGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGACTGATTCCCCTTATGATTGGCGCCCCTGATATGGCATTCCCTCGAATAAACAATATAAGCTTCTGACTTCTTCCCCCTTCTTTCCTGCTTCTATTAGCCTCTTCCGGGGTAGAAGCCGGGGCCGGAACAGGGTGAACAGTGTATCCACCTCTGGCAGGAAATCTTGCACACGCAGGAGCCTCCGTTGATTTAACCATCTTTTCCCTTCACCTAGCAGGTATTTCCTCAATTCTAGGGGCCATTAATTTTATTACAACAATTATTAATATAAAACCCCCAGCCATTTCTCAATATCAAACACCCCTATTTGTATGAGCTGTCCTAATCACGGCCGTCCTCCTTCTCCTTTCCCTTCCCGTCCTTGCCGCCGGCATCACTATACTCCTAACGGATCGTAACCTTAATACTACCTTCTTTGACCCATCTGGAGGAGGGGACCCCATTCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plectrypops lima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!