Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits shallow areas, beneath loose gravel and sand (Ref. 1602). Encountered only through the use of ichthyocides (Ref. 1602). Usually collected from over sand or sand and rock bottoms using ichthyocides from tide pools depths to 37 m (Ref. 27478). Also seen in lagoons and seaward sand patches, solitary in sand, head usually protruding (Ref 90102).
  • McCosker, J.E. 1998 A revision of the snake-eel genus Callechelys (Anguilliformes: Ophichthidae) with the description of two new Indo-Pacific species and a new Callechelyin genus. Proc. Calif. Acad. Sci. 50(7):185-215. (Ref. 27478)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea (Ref. 33390) and East Africa to the Society Islands, north to Taiwan (Ref. 48448), south to Australia.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Aldabra, Madagascar and western Mascarenes east to Society Islands, north to Taiwan, south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 174 - 183
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 870 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

87.0 cm TL (male/unsexed; (Ref. 1602))
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Yellowish white, speckled and spotted with darker coalescing spots (Ref. 3972).Description: Characterized by head length 14-16 in TL; depth of body 37-58 in TL; short tail, 2.6-2.8 in TL; dorsal fin origin slightly posterior to corner of mouth; no pectoral fins; intermaxilla with 2-4 backward slanting canines in ventral groove under snout; remaining teeth of jaws small and uniserial; uniserial vomerine teeth (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits shallow areas, beneath loose gravel and sand (Ref. 1602). Encountered only through the use of ichthyocides (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 37 m (Ref. 27478)
  • McCosker, J.E. 1998 A revision of the snake-eel genus Callechelys (Anguilliformes: Ophichthidae) with the description of two new Indo-Pacific species and a new Callechelyin genus. Proc. Calif. Acad. Sci. 50(7):185-215. (Ref. 27478)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0.5 - 19
  Temperature range (°C): 26.262 - 29.282
  Nitrate (umol/L): 0.069 - 0.402
  Salinity (PPS): 34.113 - 35.248
  Oxygen (ml/l): 4.454 - 4.700
  Phosphate (umol/l): 0.088 - 0.220
  Silicate (umol/l): 1.043 - 4.752

Graphical representation

Depth range (m): 0.5 - 19

Temperature range (°C): 26.262 - 29.282

Nitrate (umol/L): 0.069 - 0.402

Salinity (PPS): 34.113 - 35.248

Oxygen (ml/l): 4.454 - 4.700

Phosphate (umol/l): 0.088 - 0.220

Silicate (umol/l): 1.043 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 37m.
From 2 to 37 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534); also in shallow areas, beneath loose gravel and sand (Ref. 1602). Burrowing species (Ref. 75154). Encountered only through the use of ichthyocides (Ref. 1602). Usually collected from over sand or sand and rock bottoms using ichthyocides from tide pools depths to 37 m (Ref. 27478).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callechelys marmorata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACCTAGTGTTTGGTGCTTGAGCCGGAATAGTAGGTACCGCTCTAAGCCTTTTAATCCGAGCTGAGTTAAGTCAGCCTGGAGCCCTTTTAGGGGATGATCAAATCTACAATGTTATTGTTACGGCGCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAACTGACTTGTGCCATTAATAATTGGAGCCCCCGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGGCTCCTTCCTCCCTCATTCCTGCTCCTGTTAGTCTCCTCCGGAGTTGAAGCCGGAGCCGGAACAGGATGAACCGTATATCCACCCTTAGCCGGAAATCTTGCCCACGCCGGGGCCTCTGTAGATTTAACAATTTTCTCTCTCCATCTTGCCGGAGTCTCATCAATCCTGGGAGCCATCAACTTTATTACTACAATTATTAATATAAAACCCCCAGCAATTACACAATATCAAACCCCATTATTTGTTTGATCAGTCCTAGTAACTGCTGTTCTTTTACTCCTATCCCTGCCAGTCCTAGCCGCGGGTATTACAATGCTCCTAACAGACCGCAACCTAAACACAACATTCTTTGATCCAGCAGGAGGAGGAGACCCTATTCTCTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Callechelys marmorata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Callechelys marmorata

Callechelys marmorata, also known as the marbled snake eel, is a benthic Marine fish belonging to the family Ophichthidae which refers to serpentine in shape fishes.

The Marbled snake eel is a medium sized fish which grows up to 87 cm[1] .

It is widely distributed throughout the tropical waters of the Indian Ocean, Red Sea included, to the western Pacific Ocean.[2]

It inhabits the sandy and muddy bottoms close to coastal reef from 1 until 37 m depth.[3] The Marbled snake eel has a nocturnal activity.

References[edit]

  1. ^ http://eol.org/pages/1012640/details#size
  2. ^ http://www.fishbase.org/Summary/SpeciesSummary.php?id=12889
  3. ^ http://eol.org/pages/1012640/details#habitat
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!