Overview

Brief Summary

Cymatogaster aggregata (shiner surfperch) has a relatively wide distribution along the west coast of North America, stretching from southern Alaska, to Baja California, Mexico. As a highly opportunistic suction feeder, a large range of different food items are found in specimens from different regions. Shiner surfperch often migrate to shallow water estuaries during the spring and summer to breed and bear young (Woods 2007), and seasonal changes in their size distributions in various habitats often reflect these seasonal migrations (Atrim 1981). Like other perches, they are viviparous, giving live birth to about 20-24 young per year (Woods 2007, Avise & Lui 2011).

References

Atrim, B.S. 1981. Habitat and food resource utilization of three species of embiotocids in Elkhorn Slough, Monterey Bay, California. MSc Thesis. California State University, Fresno. 1-92.

Avise, J. C. and Liu, J-X. 2011. High degree of multiple paternity in the viviparous Shiner Perch, Cymatogaster aggregata, a fish with long-term female sperm storage. Marine Biology, 158:893–900.

Woods, P.J. 2007. Habitat-dependent geographical variation in ontogenetic allometry of the shiner perch Cymatogaster aggregata Gibbons (Teleostei: Embiotocidae). Journal of Evolutionary Biology, 20:5:1783-1798.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Kessler, Dimonque Lott

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Usually in shallow water, around eelgrass beds, piers and pilings and commonly found in bays and quiet back waters (Ref. 2850). Also in calm areas of exposed coast (Ref. 2850). Enter brackish and fresh waters (Ref. 2850). Found in loose schools or aggregations (Ref. 2850). Young feed mainly on copepods, while adults eat various small crustaceans, mollusks, and algae (Ref. 27547). Viviparous, female carries the developing young (Ref. 205). Exhibit seasonal onshore-offshore movements (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This fish is abundant and widespread along the Pacific coast of North America from Bahia San Quintin, Baja California, north to Port Wrangel, Alaska.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This fish is abundant and widespread along the Pacific coast of North America from Bahia San Quintin, Baja California, north to Port Wrangel, Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cymatogaster aggregata (shiner surfperch) has a relatively wide distribution along the west coast of North America. It extends from Baja California to southern Alaska. An opportunistic feeder, a large range of different food items are found in specimens from different regions (Woods 2007). Distribution can also affect aspects of shiner surfperch life history and morphology (Baltz 1984).

References
Baltz, D.M. 1984. Life history variation among female surfperches (Perciformes: Embiotocidae). Environmental Biology of Fishes, 10:3:159-171.
Woods, P.J. 2007. Habitat-dependent geographical variation in ontogenetic allometry of the shiner perch Cymatogaster aggregata Gibbons (Teleostei: Embiotocidae). Journal of Evolutionary Biology, 20:5:1783-179.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Kessler, Dimonque Lott

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Wrangell, southeastern Alaska to Bahia San Quintin, northern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 11; Dorsal soft rays (total): 19 - 22; Analspines: 3; Analsoft rays: 22 - 25; Vertebrae: 33 - 37
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pectoral fin swimming

Shiner perch swim primarily using their pectoral fins, which is called labriform swimming. One pectoral fin beat cycle is comprised of three phases: (1) abduction, when the fins are moving away from the body; (2) adduction, when the fins are moving towards the body; and (3) the refractory period, when the fins are tucked against the body.

Thrust and lift forces are generated during both abduction and adduction. The proportion of the fin cycle occupied by these two phases increases as the fish swims faster; accordingly, the proportion occupied by the refractory period decreases. Both frequency and amplitude of the fin beat increase as the fish swims faster (Webb 1973).

Shiner perch also show evidence of synchronizing mouth opening for ventilation with adduction (Webb 1975).

  • Webb, P. W. 1973. Kinematics of pectoral fin propulsion in Cymatogaster aggregata. Journal of Experimental Biology 59: 697-710.

    Webb, P. W. 1975. Synchrony of locomotion and ventilation in Cymatogaster aggregata. Journal of Experimental Biology 53: 904-907.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Joanna Mandecki

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 203 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.3 cm TL (male/unsexed; (Ref. 27547)); max. reported age: 9 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished by the rather deep, compressed body, the large scales, and the three spines in the anal fin (Ref. 27547). Lateral line slightly arched, complete (Ref. 27547). Generally silvery, with back dusky to greenish; middle of sides toward head are scales with groups of fine black dots on them, forming about eight longitudinal stripes; the stripes are often interrupted, especially in females, by three pale yellow, vertical bands; paired fins colorless; dorsal and caudal fins plain or dusky; anal fin usually colorless, sometimes with a yellow blotch toward the front (Ref. 27547). Breeding males may be almost solid black and develop fleshy lobes on both sides of anal fin (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Cymatogaster aggregata
Catalog Number: USNM 162727
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Fitch
Year Collected: 1949
Locality: California: Santa Rosa Island, California, United States, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat includes calm, shallow marine waters, bays, and estuaries, sometimes brackish or fresh water. Usually this fish occurs in shallow inshore water (e.g., around eelgrass beds, piers, pilings) during the summer; has been taken in water as deep as 146 meters during the winter (Morrow 1980, Eschmeyer and Herald 1991). Pregnant females move to shallow water before giving birth.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes calm, shallow marine waters, bays, and estuaries, sometimes brackish or fresh water. Usually this fish occurs in shallow inshore water (e.g., around eelgrass beds, piers, pilings) during the summer; has been taken in water as deep as 146 meters during the winter (Morrow 1980, Eschmeyer and Herald 1991). Pregnant females move to shallow water before giving birth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cymatogaster aggregata (shiner surfperch) move into estuaries in the late springand early summer to breed. During this time, they can make up much of biomass of the estuaries they inhabit (Woods 2007).

References
Woods, P.J. 2007. Habitat-dependent geographical variation in ontogenetic allometryof the shiner perch Cymatogaster aggregata Gibbons (Teleostei: Embiotocidae). Journal of Evolutionary Biology, 20:5:1783-179.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Kessler, Dimonque Lott

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; non-migratory; freshwater; brackish; marine; depth range ? - 146 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 757 specimens in 1 taxon.
Water temperature and chemistry ranges based on 356 samples.

Environmental ranges
  Depth range (m): 0.455 - 203.5
  Temperature range (°C): 7.114 - 8.705
  Nitrate (umol/L): 13.007 - 27.924
  Salinity (PPS): 32.561 - 33.799
  Oxygen (ml/l): 2.801 - 5.506
  Phosphate (umol/l): 1.398 - 2.300
  Silicate (umol/l): 21.984 - 43.852

Graphical representation

Depth range (m): 0.455 - 203.5

Temperature range (°C): 7.114 - 8.705

Nitrate (umol/L): 13.007 - 27.924

Salinity (PPS): 32.561 - 33.799

Oxygen (ml/l): 2.801 - 5.506

Phosphate (umol/l): 1.398 - 2.300

Silicate (umol/l): 21.984 - 43.852
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 146m.
Recorded at 146 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Moves onshore-offshore seasonally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on zoobenthos and plants (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic. Diet varies with size of fish and season. Young feed mostly on copepods. Adults eat a variety of small crustaceans, mollusks and algae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Cymatogaster aggregata (blacksmith, black perch, rubber lip sea perch, sharpnose sea perch, shiner perch) preys on:
zooplankton

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Found in large schools.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous. Mating is preceded by courtship. The male moves slowly toward the female, who retreats. Her flight stimulates pursuit by up to 10 males. During the pursuit, males attempt to bring their anal regions in contact with that of the female. One male heads off the female, urging her away from the group of males and also driving them away. The female is conducted to the shelter of a rock or other object, where the courtship dance begins. In this dance, the male, with dorsal fin fully erect, swims by means of his pectoral fin in a figure eight pattern over the female, udulating in both the horizontal and vertical planes. The male then stops, faces the female head to head, quivers, then moves his jaws and undulates his dorsal fin. He then moves beside the female, facing in the same direction, and repeats the movements. Finally, the male tilts on his side, the female tilts slightly away from hin, and the anal regions are brought in contact with each other. Copulation lasts less than a second. Gestation takes five to six months. Bears 3 to 36 young. Female carries the developing young (Ref. 205). Males are mature and ripe at birth. Juvenile females are mated soon after being born (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Female Cymatogaster aggregata are viviparous (birth live young) and can potentially store sperm for long time periods. These characteristics may lead to multiple paternity, where one female may give birth to multiple young with different fathers (as cited in Avise & Lui 2011).

References

Avise, J. C. and Liu, J-X. 2011. High degree of multiple paternity in the viviparous Shiner Perch, Cymatogaster aggregata, a fish with long-term female sperm storage. Marine Biology, 158:893–900.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Sarah Kessler, Dimonque Lott

Source: Biology 260 Occidental College

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males mature at birth; juvenile females mate soon after birth. Spawns May-August, mostly June and early July. Delayed fertilization. Gestation 5-6 months, 3-36 young are born in June or July (Morrow 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cymatogaster aggregata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cymatogaster aggregata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACTGGCCTCAGTCTACTAATCCGGGCAGAACTAAGCCAACCAGGCGCCCTCCTCGGAGAT---GACCAGATTTACAATGTAATTGTAACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCCGTCATAATCGGCGGCTTTGGGAACTGGCTCGTCCCACTAATAATTGGTGCCCCCGATATGGCCTTCCCCCGAATAAACAACATGAGTTTCTGACTGCTTCCCCCATCGTTTCTGCTTCTTCTAGCATCTTCCGGAGTAGAAGCTGGCGCCGGAACCGGATGAACTGTATACCCGCCTCTTTCAGGCAATCTCGCTCATGCAGGGGCTTCCGTAGACTTAACTATCTTCTCCCTCCATCTTGCAGGAATCTCCTCGATTTTAGGCGCAATCAACTTTATTACAACTATTTTTAATATAAAACCCCCAACTGTCTCACAATACCAAATACCCCTGTTTGTCTGGTCCGTCCTGATCACAGCCGTCCTCCTGCTTCTTTCTCTGCCAGTTCTTGCCGCTGGCATCACCATGCTACTAACTGACCGAAACCTAAATACTACCTTCTTTGACCCTGCAGGTGGGGGAGACCCCATTCTTTACCAACATTTATTCTGGTTCTTTGGCCATCCTGAGGTGTATATTCTCATTTTACCAGGGTTTGGTATAGTTTCTCATATTGTAGCTTACTACTCGGGGAAAAAAGAACCTTTTGGTTACATAGGCATAGCCTGAGCAATAATAGCCATCGGCCTCCTAGGCTTTATTGTCTGAGCTCACCACATGTTTACAGTTGGGATGGACGTAGACACACGAGCATATTTTACATCTGCGACCATAATCATCGCAATCCCAACTGGTGTAAAAGTCTTTAGTTGACTAGCCACCCTCCACGGAGGT---GCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but very large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; bait: occasionally; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Shiner perch

The shiner perch (Cymatogaster aggregata) is a common surfperch found in estuaries, lagoons, and coastal streams along the Pacific coast from Alaska to Baja California. It is the sole member of its genus.

Female

Shiner perches are similar to tule perches, deep-bodied with a dusky greenish back and silvery sides that have a pattern combining fine horizontal bars with three broad yellow vertical bars. Breeding males turn almost entirely black, the barred pattern being obscured by dark speckles. Shiner perches are distinguished from tule perches by having fewer dorsal fin spines, just 8–9 vs the 15–19 of the tule perch. The rayed part of the dorsal fin has 18 to 23 rays. The anal fin has 3 spines followed by 22–25 rays.

They are one of the most common fish in the bays and estuaries of their range, favoring beds of eelgrass, and often accumulating around piers as well. They feed on zooplankton such as copepods, but have been observed to bottom feed as well.

References[edit]

  • Peter B. Moyle, Inland Fishes of California (University of California Press, 2002), pp. 428-429
  • Froese, Rainer and Pauly, Daniel, eds. (2006). "Cymatogaster aggregata" in FishBase. April 2006 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: One of two species in the genus. Includes C. gracilis of the northern Channel Islands (southern California), which formerly was regarded as a distinct species (see Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!