Overview

Comprehensive Description

Description: Body relatively thin, long and narrow with a large eye and a pointed snout and a terminal small mouth. Pectoral fins medium. Pelvic fins very short. Dorsal and anal-fin bases relatively long, caudal peduncle short and somewhat narrow. Melanophores occur internally around the gut near the vent, and in a row of 11, 12, or occasionally 13 (but rule out Sparisoma when 13) discrete round melanophores along the base of the anal fin and extending into the caudal peduncle (often missing the last in the series). The melanophores in the row after the last fin ray are not at the ventral midline but can be well into the caudal peduncle musculature. Series of transitional larvae show development of the eye from a narrowed vertical oval tilted forward with a small posterior-inferior extension of the iris to much larger and round at and after transition. Many pre-transitional larvae have a marked ventral indentation in the iris. Transitional larvae develop a few scattered melanophores on the top of the head and two arcs from the mid and upper eye across the top of the head (transitional Sparisoma have a similar upper arc but do not have the arc starting at the mid-eye).

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Inhabits seagrass beds and weedy areas with sand (Ref. 9710). Feeds on seagrasses (Ref. 9710). Buries in the sand to sleep in a mucus tube (Ref. 9710). Protogynous hermaphrodite (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found from Bermuda, South Carolina (Smith 1997) to southern Florida (USA), Bahamas, Antilles to Santa Catarina, Brazil, including Atoll das Rocas and Fernando de Noronha.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Bermuda, southern Florida (USA), and Bahamas to Brazil (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 2; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 7251))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: Fin-ray counts of D-IX,10 A-III,9 are shared by all Caribbean parrotfishes, however pectoral-fin ray counts divide parrotfishes into two groups: Sparisoma, Cryptotomus roseus, and Nicholsina usta all have 13 pectoral-fin rays, while Scarus have a mode of 14-16 pectoral-fin rays (the wrasse Doratonotus megalepis also shares the median fin-ray count but has 11-12 pectoral-fin rays). This larval type develops into Cryptotomus roseus when raised in captivity, but the demarkation between C. roseus and Sparisoma is unclear. Larval Nicholsina usta cannot be excluded from the type until those larvae are identified (adults of the species are not found at the collection site in Panama). (R)

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Jaw teeth fused only at bases. Anterior nostril without membranous flap (Ref. 26938). Male color, olivaceous on the back with small pink dots; a salmon stripe along the side with a row of green dots; body below stripe light green with some salmon markings on scales (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype; Paralectotype for Cryptotomus roseus
Catalog Number: USNM 163555
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): T. Bean
Year Collected: 1905
Locality: Bermuda: Coopers Island, Bermuda, Atlantic
  • Syntype: Bean, T. H. 1906. Proceedings of the Biological Society of Washington. 19: 32.; Paralectotype: Bean, T. H. 1906. Proceedings of the Biological Society of Washington. 19: 32.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Analogues: C. roseus is primarily identified by the absence of the characteristic lateral melanophore of Sparisoma in a pre-transitional larva (does not apply to transitional larvae). Additional characters that may assist are the loss (or fading out) of one or more of the last few anal row melanophores, which correlates well with no lateral melanophore (also only applicable to pre-transitional larvae). Most C. roseus larvae do have fewer than 13 melanophores in the anal-fin row. Lastly, the snout is usually sharply-pointed in this larval type. Unfortunately, transitional Sparisoma larvae can lose their lateral melanophore and show a reduced complement of anal row melanophores: thus the distinction becomes difficult at early transition before the metamorphic melanophore pattern starts. Furthermore, there is the possibility that some rare pre-transition Sparisoma do lack the lateral melanophore and/or the full 13 anal row melanophores (some larvae have 12 in the row, but are missing the first and not the last). DNA sequence analyses underway at present should resolve this potential overlap.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in seagrass beds, macroalgae, coral rubble or around stands of gorgonians and soft coral, or on coral and rocky reefs to depths of 30 m (Carvalho-Filho 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range ? - 60 m (Ref. 13628)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 51 specimens in 1 taxon.
Water temperature and chemistry ranges based on 26 samples.

Environmental ranges
  Depth range (m): 0.5 - 35
  Temperature range (°C): 23.797 - 27.537
  Nitrate (umol/L): 0.174 - 0.793
  Salinity (PPS): 34.880 - 37.169
  Oxygen (ml/l): 4.519 - 4.813
  Phosphate (umol/l): 0.075 - 0.121
  Silicate (umol/l): 0.993 - 2.134

Graphical representation

Depth range (m): 0.5 - 35

Temperature range (°C): 23.797 - 27.537

Nitrate (umol/L): 0.174 - 0.793

Salinity (PPS): 34.880 - 37.169

Oxygen (ml/l): 4.519 - 4.813

Phosphate (umol/l): 0.075 - 0.121

Silicate (umol/l): 0.993 - 2.134
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 60m.
Recorded at 60 meters.

Habitat: demersal. Found in clear waters usually in association with @Thalassia@. Feeds on seagrasses. Buries in the sand to sleep in a mucus tube (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Forms leks during breeding (Ref. 55367). A monandric species (Ref. 55367). Length at sex change = 5.75 cm TL (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cryptotomus roseus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTTGTATTTGGTGCCTGAGCTGGAATAGTGGGCACCGCTCTAAGCCTTCTAATCCGAGCCGAACTGAGCCAACCTGGAGCCCTCCTCGGAGATGACCAGATCTATAATGTAATTGTTACCGCCCACGCATTCGTAATAATCTTTTTTATAGTAATGCCTATCATGATTGGGGGCTTTGGGAACTGATTAATCCCACTTATGATTGGAGCACCAGATATGGCTTTCCCCCGAATGAACAACATGAGCTTCTGACTTCTCCCCCCTTCTTTCCTTCTGCTGCTTGCTTCATCAGGAGTAGAAGCCGGAGCAGGAACAGGCTGAACCGTATACCCACCATTAGCGGGGAATCTTGCACATGCTGGGGCCTCTGTAGATCTAACAATCTTCTCTCTTCATCTTGCAGGAATTTCATCTATCTTAGGAGCAATTAATTTCATTACAACAATTGTCAACATGAAACCTCCCGCAATTTCACAATACCAAACGCCTTTATTTGTATGAGCCGTTCTAATCACCGCTGTCCTCCTTCTTCTTTCGCTGCCAGTTCTTGCTGCAGGGATTACAATGTTGCTTACTGACCGGAACCTAAACACTACATTCTTTGACCCCGCGGGCGGAGGAGACCCTATTCTTTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cryptotomus roseus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Bertoncini, A.A., Sampaio, C.L.S., Rocha, L.A., Ferreira, C.E., Francini-Filho, R., Moura, R., Gaspar, A.L. & Feitosa, C.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is relatively widespread in the Caribbean and Brazil, but is naturally uncommon. There are no major threats known for this species. It is listed as Least Concern. However, more research is needed on population and habitat status and harvest levels.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is naturally uncommon. Densities in shallow rocky reefs in Southeast Brazil obtained with Underwater Visual Census are in the order of 0.3 to 0.56 individuals per 40 m2 (Floeter et al. 2007), 0.33 individuals per 40 m2 Baixo-sul baiano. Lower densities occur along its southern limit, South Brazil (Santa Catarina) 0.1 individuals per 40 m2 (Bertoncini and Sampaio pers comm 2008). Along the Brazilian coast, it is more common from Bahia to São Paulo and is considered rare in Santa Catarina state (Smith 1997, Hostim-Silva et al. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution includes a number of Marine Protected Areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!