Overview

Brief Summary

Biology

The bullhead is crepuscular; it spends the day under stones or in vegetation and emerges at dusk to feed on small bottom-dwelling invertebrates such as insect larvae and crustaceans, as well as the eggs and larvae of other fish (5) (8). They are occasionally cannibalistic, particularly of eggs in other nests (5). Bullheads are visual, ambush predators, and are good swimmers, moving quickly in short, sharp darts along the bed (5). The spawning season occurs between February and June, and fertilisation is external (8). The eggs are laid underneath stones or in a pit, and then guarded and cared for by the male who fans them to ensure that they receive enough oxygen (9). The eggs hatch two to four weeks later, and the larvae feed on their yolk sac for a further two weeks before dispersing. Maturity is reached within two years (10). Bullheads often behave aggressively towards one another, and competition for shelter and foraging space can be intense; research is currently being carried out by the University of Southampton into this area (5). Being small, bullheads are vulnerable to a wide range of predators, particularly brown trout, pike, grey heron, kingfisher and dippers (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The bullhead is the only freshwater member of the family Cottidae that is native to the UK. It is a small fish, with a large mouth (4), large pectoral fins, prominent eyes (5) and a wide flattened head; hence the common names 'bullhead' and 'miller's thumb' (4). They are brownish in colour with mottling or barring, and pale undersides (6). During the spawning period males become black in colour with a white-tipped dorsal fin, and females become plump (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Occurs in cold, clear and fast-flowing water of small stream to medium-sized rivers as well as on gravel or rocky shores of cold lakes and in slightly brackish waters along eastern coast of Baltic coast (Ref. 59043). Feeds on small bottom invertebrates, mainly insects, crustaceans. Pink to yellow eggs are found in clumps attached to undersides of large stones (Ref. 41678). Contrary to statements in older literature, eggs and larvae of fishes are not a common food item (Ref. 45167).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Northern Baltic basin in Scandinavia south to stream Maurine (53°51'N 10°56'E) in southwesternmost corner of Baltic basin (Germany). Lower reaches of streams and rivers and along coast of Sweden, Finland, Russia southwest to Estonia. Danube (except upper tributaries Save and Arges), Elbe, Ems, Weser and Rhône drainages. Tributaries of upper Rhine downriver (northward) to about Mannheim. A few of the uppermost tributaries of River Tevere, Central Italy. Adriatic drainages, from Potenza (Italy) to Zrmanja (Croatia), except Timavo spring (inhabited by C. scaturigo). mtDNA and microsatellite data show that sculpins from the stream Steenputbeek (4°17'N 50°43'E) in Scheldt drainage represent C. gobio, suspected to be introduced. Sculpins reported from Neretva drainage (Bosnia-Herzegovina) probably also belong to C. gobio.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe: North Baltic in Scandinavia south to stream Maurine in southwesternmost of corner of Baltic basin (Germany); lower reaches of streams and rivers and along coast of Sweden, Finland, Russia southwest to Estonia.; Danube (except upper tributaries Save and Arges), Elbe, Ems, Weser and Rhône drainages;tributaries of upper Rhine downriver (northward) to about Mannheim; a few of uppermost tributaries of River Tevere, central Italy; Adriatic drainages from Potenza in Italy to Zrmanja in Croatia, except Timavo spring. Locally introduced in Scheldt drainage in Belgium. Records of sculpins from Neretva drainage in Bosnia-Herzegovina possibly belong to Cottus gobio.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The bullhead is widely distributed in England and Wales but in Scotland is only known from the Forth and Clyde catchments (7). Elsewhere, the species is found in Europe, but it does not have such a favourable status there, and so it is listed in Annex II of the Habitats Directive (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 8; Dorsal soft rays (total): 15 - 18; Analspines: 0; Analsoft rays: 10 - 13; Vertebrae: 31 - 34
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 556)); max. reported age: 10 years (Ref. 74370)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin with 13 to 14 rays (Ref. 40476).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Cold, clear and fast-flowing water of small stream to medium-sized rivers. As well on gravel or rocky shores of cold lakes and in slightly brackish waters along eastern Baltic coast.

Biology:
Spawns for the first time at 2-4 years. Spawns in March-April, when temperature rises above 12°C. Females spawn once a year. Most individuals spawn for several years. They lay adhesive eggs in a compact clutch on ceiling of small cavities in gravel or rock bottom. Males guard eggs until hatching; a single male may guard the egg clutches of several females. Feeds on a wide variety of benthic invertebrates.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish; pH range: 7.0 - 7.5; dH range: 10; depth range 2 - 2 m (Ref. 58018)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 26 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 1.6 - 69
  Temperature range (°C): 5.286 - 9.686
  Nitrate (umol/L): 1.687 - 6.499
  Salinity (PPS): 5.722 - 34.708
  Oxygen (ml/l): 6.095 - 8.684
  Phosphate (umol/l): 0.114 - 0.535
  Silicate (umol/l): 3.113 - 14.483

Graphical representation

Depth range (m): 1.6 - 69

Temperature range (°C): 5.286 - 9.686

Nitrate (umol/L): 1.687 - 6.499

Salinity (PPS): 5.722 - 34.708

Oxygen (ml/l): 6.095 - 8.684

Phosphate (umol/l): 0.114 - 0.535

Silicate (umol/l): 3.113 - 14.483
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in freshwater streams, rivers and lakes with hard stony substrates and shows a preference for fast flowing, shallow water bodies (7) (8). The large pectoral fins enable bullheads to hold their position in fast flowing water (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Carnivorous, preys voraciously on moving animals which are swallowed whole (Ref. 46230). Feeds on small bottom invertebrates, chiefly insects (Ephemeroptera nymphs, larvae of Plecoptera and Trichoptera), crustaceans (amphipods, gammarids, crayfishes), also eggs and larvae of fishes (Ref. 4698). Short-lived species (Ref. 46230).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns once a year for several years in low productivity streams, but exhibits multiple spawning within a season in high productivity environments (Ref. 40290, 40754). Also Ref. 26506. Male protects several batches of eggs--deposited below a stone--for about 3 weeks. Larvae are not guarded and may occasionally been eaten (Ref. 45166).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cottus gobio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 83
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cottus gobio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTCCTAATTCGAGCAGAACTAAGCCAACCCGGCGCCCTTTTGGGGGACGACCAGATTTATAATGTAATTGTTACAGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATAATCGGAGGTTTCGGGAACTGGCTAGTTCCCCTAATGATCGGCGCTCCTGATATGGCCTTTCCTCGAATGAATAATATGAGCTTTTGACTCCTTCCCCCATCTTTTTTACTCCTCCTTGCCTCTTCGGGGGTCGAAGCAGGTGCCGGAACCGGATGAACAGTCTACCCGCCCCTCGCCGGAAACCTAGCCCACGCAGGAGCCTCTGTTGACCTAACAATCTTCTCCCTTCACCTAGCAGGTATCTCCTCTATTCTTGGGGCAATCAACTTTATCACAACTATCATCAATATGAAACCCCCTGCCATTTCACAATACCAGACCCCGCTCTTCGTATGATCTGTCCTTATTACTGCTGTCCTACTGCTTCTTTCTCTCCCCGTACTTGCCGCCGGCATCACAATGCTCCTAACAGACCGAAACCTTAACACCACCTTCTTTGACCCTGCCGGAGGGGGAGACCCAATCCTTTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Freyhof, J.

Reviewer/s
Kottelat, M. & Smith, K.

Contributor/s
Kottelat, M.

Justification
A widespread species with no known major widespread threats, however several populations are locally threatened. Future research on C. gobio is likely to show that it is in fact an assemblage of several species and each should be re-evaluated.

European Union 27 = LC. Same rationale as above.


History
  • 2008
    Least Concern
    (IUCN 2008)
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Listed on Annex II of the EC Habitats Directive (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The reasons for the poor status of this species in Europe are unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

A number of areas have been selected as candidate Special Areas of Conservation (SACs) (7) in order to reflect a variety of ecological situations and the geographical range of the bullhead (7). This should help to secure a strong conservation status for this fish, but it is thought that further measures will be required to maintain the UK population (7). The life in UK Rivers Project is helping to conserve this species (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

European bullhead

Deep fried bullhead

The bullhead[1][2][3] (Cottus gobio) is a freshwater fish that is widely distributed in Europe, mainly in rivers. It is a member of the Cottidae family, a type of sculpin. It is also known as the miller's thumb, freshwater sculpin, common bullhead and European bullhead.[2][3]

The bullhead is a small demersal fish that lives both in cold, clear, fast-flowing small streams and in middle-sized rivers. It also occurs on gravelly shores of cold lakes. Further, it thrives in diluted brackish water of the Northern Baltic Sea.[2]

Description[edit]

The bullhead has a large broad head and tapering body, large fins and a rounded tail. The eyes are located near the top of the head. This fish resembles the Alpine bullhead and the freshwater form of the fourhorn sculpin. It can be told from the former by the fact that the rays of its pelvic fins are of similar lengths while the first and last rays are longer in the Arctic bullhead. It can be distinguished from the fourhorn sculpin by the fact that the dorsal and anal fins terminate close to the tail giving a short caudal peduncle. When it rests on the bottom, the pectoral fins flare out resembling wings. The bullhead is usually about 6 to 8 cm (2.4 to 3.1 in) long and is light brown mottled with darker colour. The pelvic fins are colourless and lack the stripes of the Alpine bullhead.[4]

Biology[edit]

Food items eaten by the bullhead include benthic insects, crustaceans and other invertebrates.[2] It breeds in the spring. The male digs a shallow hollow in which batches of eggs are deposited by several females. He then guards the nest for the month or so that it takes for the eggs to hatch.[4]

References[edit]

  1. ^ Cottus gobio IUCN Red List 2009
  2. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2005). "Cottus gobio" in FishBase. 10 2005 version.
  3. ^ a b "Cottus gobio". Integrated Taxonomic Information System. Retrieved 24 January 2006. 
  4. ^ a b "Bullhead: Cottus gobio". NatureGate. Retrieved 2013-12-17. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!