Overview

Comprehensive Description

Biology

Inhabits clear lagoon and seaward reefs to over 15 m (Ref. 9710). Feeds on small crabs and gastropods.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Marshall Islands, north to southern Japan, south to the Great Barrier Reef and Tonga.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from the Maldives to Marshall Islands, north to southern Japan, south to Sydney, Tonga and Pohnpei (G. Allen unpublished survey). It is also present on the Ashmore reefs in Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Greenish with pink markings on dark substrate. Very pale when on white sand substrates and dorsal spots is lost in large males (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine, usually 2 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs in depths from 1-34 m and reaches a maximum size of 15.1 cm. It is typically found on protected reefs where there is more sand and rubble than coral.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 0.915 - 23
  Temperature range (°C): 25.709 - 28.954
  Nitrate (umol/L): 0.068 - 0.622
  Salinity (PPS): 32.200 - 35.312
  Oxygen (ml/l): 4.427 - 4.727
  Phosphate (umol/l): 0.055 - 0.339
  Silicate (umol/l): 1.005 - 4.465

Graphical representation

Depth range (m): 0.915 - 23

Temperature range (°C): 25.709 - 28.954

Nitrate (umol/L): 0.068 - 0.622

Salinity (PPS): 32.200 - 35.312

Oxygen (ml/l): 4.427 - 4.727

Phosphate (umol/l): 0.055 - 0.339

Silicate (umol/l): 1.005 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coris batuensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTCGGGGCCTGGGCCGGAATGGTGGGCACAGCCTTAAGCTTACTTATCCGCGCGGAACTAAGCCAACCCGGCGCCCTCCTTGGAGAC---GACCAAATTTACAATGTAATTGTTACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTAATACCTATTATGATTGGGGGCTTTGGAAACTGACTTATTCCTTTAATGATTGGGGCACCTGACATGGCCTTCCCTCGAATGAACAACATGAGCTTCTGACTCCTGCCCCCATCATTCCTCCTTCTCCTCGCCTCCTCAGGTGTAGAAGCAGGTGCAGGGACCGGCTGAACAGTCTACCCGCCCCTGGCAGGGAACCTGGCCCACGCCGGAGCCTCTGTTGATCTGACTATCTTCTCACTTCACTTAGCTGGCATTTCGTCAATTCTAGGAGCAATTAATTTTATTACTACTATTATTAATATGAAACCCCCTGCCATCTCCCAGTACCAAACCCCTCTTTTCGTCTGAGCCGTTCTAATTACAGCAGTCCTCCTCCTTCTCTCCCTCCCTGTATTAGCTGCCGGCATCACTATGCTTCTCACAGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGCGGTGACCCCATCCTCTACCAACATTTATTCTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coris batuensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Craig, M. & Yeeting, B.

Reviewer/s
Rocha, L.A. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and common in the Indo-Pacific region. No major threats are known for this species. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species at the moment. However, this species is considered common.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures in place. However, species is well protected throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!