Articles on this page are available in 2 other languages: Arabic (15), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

An inshore pelagic species that feeds mainly on small fishes, but also crabs (Ref. 5213). Marketed fresh or frozen.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to the Solomon Islands, south to Australia (Ref. 33390). Questionably occurring in the Mascarenes (Ref. 33390). Probably similar to that of Chirocentrus dorab, but not always distinguished from that species (Ref. 188).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Durban (South Africa), Madagascar and Seychelles east to Philippines and New Guinea, north to southern Japan, south to Western Australia and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Anal spines: 0; Analsoft rays: 0
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm SL (male/unsexed; (Ref. 188)); max. published weight: 410 g (Ref. 4883)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

An inshore pelagic species that feeds mainly on small fishes, but also crabs (Ref. 5213). Marketed fresh or frozen.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Scales numerous, small, usually lost. Silvery; back bright blue (fading to grey); flanks bright silver.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine; depth range 0 - 150 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 35.5 - 35.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 150m.
Recorded at 150 meters.

Habitat: pelagic. An inshore pelagic species that feeds mainly on small fishes, but also crabs (Ref. 5213). Marketed fresh or frozen.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf (Ref. 75154).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chirocentrus nudus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTGTACATAATCTTCGGTGCCTGAGCAGGGATAGTAGGCACAGCCCTGAGCCTACTCATCCGAGCCGAGCTAAGTCAACCGGGGGCCCTTCTTGGAGACGACCAGATCTACAACGTTATTGTTACTGCGCATGCTTTCGTAATGATTTTCTTTATGGTCATACCTATCCTTATCGGGGGATTCGGAAATTGACTGATCCCCTTAATGATCGGAGCACCCGATATGGCCTTCCCCCGCATGAATAATATAAGTTTTTGACTTTTACCCCCCTCGTTCCTCCTGCTGCTGGCCTCATCTGCAGTCGAGGCCGGGGCGGGCACCGGGTGGACAGTCTACCCACCCCTAGCCGGCAATCTGGCCCACGCGGGAGCTTCAGTGGATCTCACCATTTTCTCGCTCCACTTAGCAGGGGTCTCCTCTATTCTAGGGGCTATCAATTTTATTACTACAATCATCAACATAAAACCCCCCGCTATCTCACAATACCAAACACCCCTCTTCGTCTGAGCTGTACTAGTCACCGCAGTACTACTCCTGCTCTCTCTCCCTGTTCTGGCGGCCGGAATTACAATACTGCTTACAGACCGAAACCTAAACACGACCTTTTTCGACCCGGCTGGCGGAGGGGACCCGATCCTCTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chirocentrus nudus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: medium; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!