Overview

Comprehensive Description

Biology

Abundant in shallow coastal waters, from mangroves and sandy beaches to wrecks and harbors. Juveniles (black phase) are common in estuaries and often found in very shallow water swimming at an angle resembling dead leaves or as infertile red mangrove pods and other debris. Adults often occur in very large schools of up to 500 individuals (Ref. 9710). Feed on benthic invertebrates like crustaceans, mollusks, annelids, cnidarians as well as on plankton (Ref. 35237). Good food fish (Ref. 5521); marketed fresh (Ref. 5217). Often circles divers (Ref. 9710). Minimum depth from Ref. 9710. In southeastern Brazil found between 23 and 45 m (Ref. 47377). Has been reared in captivity (Ref. 35425).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: New England, Massachusetts, USA and northern Gulf of Mexico to southeastern Brazil, Rio Grande do Sul
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA and northern Gulf of Mexico to Rio Grande do Sul, Brazil (Ref. 47377).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 21 - 24; Analspines: 3; Analsoft rays: 17 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 7251)); max. published weight: 9,000 g (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Very deep-bodied, compressed, disk-shaped fish with a very blunt snout. Irregular, bold, blackish, vertical bands that fade with age. Second dorsal and anal fins have high anterior lobes (Ref. 26938). Mouth small, the maxilla of adults ending beneath nostrils; no teeth on roof of mouth; scales ctenoid; head and fins scaled; opercle ends in an obtuse point (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); brackish; marine; depth range 3 - 35 m (Ref. 26912)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1179 specimens in 1 taxon.
Water temperature and chemistry ranges based on 291 samples.

Environmental ranges
  Depth range (m): 0 - 2869
  Temperature range (°C): 2.457 - 27.999
  Nitrate (umol/L): 0.174 - 17.473
  Salinity (PPS): 33.112 - 36.375
  Oxygen (ml/l): 3.728 - 6.300
  Phosphate (umol/l): 0.019 - 1.169
  Silicate (umol/l): 0.756 - 21.075

Graphical representation

Depth range (m): 0 - 2869

Temperature range (°C): 2.457 - 27.999

Nitrate (umol/L): 0.174 - 17.473

Salinity (PPS): 33.112 - 36.375

Oxygen (ml/l): 3.728 - 6.300

Phosphate (umol/l): 0.019 - 1.169

Silicate (umol/l): 0.756 - 21.075
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 35m.
From 3 to 35 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Abundant in shallow coastal waters, from mangroves and sandy beaches to wrecks and harbors. Juveniles (black phase) are common in estuaries and often found in very shallow water swimming at an angle resembling dead leaves or as infertile red mangrove pods and other debris. Adults often occur in very large schools of up to 500 individuals (Ref. 9710). Feed on benthic invertebrates like crustaceans, mollusks, annelids, cnidarians as well as on plankton (Ref. 35237).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chaetodipterus faber

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 38
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chaetodipterus faber

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTCGGTGCTTGGGCCGGAATAGTAGGCACAGCACTAAGCCTGCTCATCCGAGCCGAACTCAACCAACCCGGCGCTCTCCTAGGAGACGACCAAATTTATAATGTAATTGTTACGGCGCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGGCTGATCCCATTAATGATCGGCGCCCCAGACATGGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTCCTTCCCCCCTCGTTCCTACTCCTCCTTGCCTCTTCTGGTGTAGAGGCGGGTGCGGGAACTGGCTGAACCGTTTACCCCCCACTAGCCGGCAACCTAGCACACGCTGGGGCATCCGTTGACCTAACCATTTTTTCCCTACACCTGGCAGGTGTTTCCTCAATTCTTGGGGCAATTAATTTTATCACAACAATTATCAACATGAAACCTCCCGCCATTTCCCAATACCAAACCCCCCTATTTGTATGAGCCGTCCTAATCACTGCCGTTCTCCTGCTCCTCTCACTCCCAGTCCTTGCTGCCGGCATTACCATGCTGCTTACAGACCGAAACCTAAACACCACCTTTTTCGACCCGGCGGGAGGAGGAGACCCGATTCTTTACCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Atlantic spadefish

The Atlantic spadefish (Chaetodipterus faber) is a species of marine fish endemic to the western Atlantic Ocean. They are commonly found in shallow waters off the coast of the southeastern United States and in the Caribbean.[2]

Due to their reputation as strong fighters, they are popular game fish, especially during the summer months when they are most active.[3][4]

Naming and taxonomy[edit]

The Atlantic spadefish is known by numerous colloquial names, including angelfish, white angelfish, threetailed porgy, ocean cobbler, and moonfish.[5][6]

The Atlantic spadefish belongs to the genus Chaetodipterus, which includes two other species: the West African spadefish (Chaetodipterus lippei) and the Pacific spadefish (Chaetodipterus zonatus).[7] The Chaetodipterus genus belongs to the Ephippidae family, which includes spadefish and batfish.

Description[edit]

The Atlantic spadefish has a very deep, compressed, disk-shaped body and a blunt snout. The second dorsal and anal fins of adults have long, trailing anterior lobes, giving an "angelfish-like" appearance. The body is silver in color with irregular black vertical bands that fade gradually with age. The mouth is small, with the maxilla of adults ending beneath the nostrils.[2] Specimens commonly weigh from 3 to 10 pounds (1.4 to 4.5 kg), although individuals as large as 20 pounds (9 kg) have been recorded.[2][4] Their maximum length is about 36 inches (91 cm).[2]

Sport fishing[edit]

A large Atlantic spadefish caught off the coast of Virginia.

The Atlantic spadefish has become a popular target species for sportfishermen due to their abundance and the strong fight they have for their size. They are good table fare, especially if smoked or grilled. A common method of catching involves using small pieces of clam on a small circle hook.

References[edit]

  1. ^ "Chaetodipterus faber". Integrated Taxonomic Information System. Retrieved 25 June 2008. 
  2. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2008). "Chaetodipterus faber" in FishBase. June 2008 version.
  3. ^ Burleson, Jeff (19 June 2006). "Aces of Spades". South Carolina Sportsman. "Sometimes referred to as 'bluegills on steroids,' spadefish are one of the hardest-fighting fish in the ocean, compared pound-for-pound to other fish of similar size." 
  4. ^ a b Ward, Artemas (1911). "Angel fish". The Grocer's Encyclopedia. New York. 
  5. ^ "Common Names of Chaetodipterus faber". FishBase. Retrieved 25 June 2008. 
  6. ^ Cassidy, Frederic Gomes; Joan Houston Hall (2003). Dictionary of American Regional English. Harvard University Press. p. 288. 
  7. ^ "Chaetodipterus". Integrated Taxonomic Information System. Retrieved 25 June 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!