Overview

Distribution

Central America: southern Mexico (Quintana Roo) to northern Honduras and Colombia (Islas de Providencia).
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Yucatán Peninsula, Quintana Roo, northern Honduras, Belize, and offshore islands: Belize, Colombia, Honduras and Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 56 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

5.6 cm SL (male/unsexed; (Ref. 30499))
  • Greenfield, D.W. and J.E. Thomerson 1997 Fishes of the continental waters of Belize. University Press of Florida, Florida. 311 p. (Ref. 30499)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; non-migratory; freshwater; brackish
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Poecilia orri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGCATAGTGGGAACAGCTCTGAGTCTTTTAATCCGAGCCGAACTCAGTCAACCAGGATCCCTCCTAGGCGATGATCAAATTTATAATGTAATCGTCACAGCTCATGCCTTTGTAATAATCTTTTTTATAGTTATGCCAATTATAATTGGCGGCTTCGGTAATTGATTAGTACCACTAATAATTGGTGCCCCTGATATAGCCTTTCCACGAATAAATAATATGAGCTTCTGACTTCTACCGCCCTCATTCCTCCTCCTCCTAGCATCTTCTGGGGTAGAAGCAGGGGCTGGTACAGGTTGAACCGTCTACCCACCTCTTGCAGGCAATTTAGCCCACGCTGGACCCTCTGTAGATCTAACTATTTTTTCACTCCACCTGGCAGGTATTTCCTCCATCCTAGGGGCAATCAACTTTATTACCACTATTATTAATATAAAACCCCCTGCAGCATCTCAATACCAAACACCCCTATTTGTCTGAGCTGTAATGATTACAGCTGTACTTCTGCTTCTCTCCCTTCCTGTACTCGCCGCTGGCATCACCATGCTTCTGACAGATCGAAATCTAAATACCACTTTCTTCGACCCTGCAGGAGGGGGAGATCCAATTCTTTATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Poecilia orri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!