Overview

Comprehensive Description

Biology

Found in coastal tropical and warm temperate waters, occasionally offshore. Sometimes found in small groups (Ref. 5578). Feed on bottom-living crustaceans and mollusks. Ovoviviparous (Ref. 50449), aplacental (Ref. 57025). Prized angling fish, often released (Ref. 5578). Flesh highly esteemed (Ref. 3965).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Greek Exclusive Economic Zone, Israeli part of the Mediterranean Sea - Eastern Basin, Kenya, Mozambique, Portuguese Exclusive Economic Zone, South Africa (country), Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic: Portugal and Morocco to Angola, including the Mediterranean, Madeira and the Canary Islands; then from Saldanha Bay to Natal (South Africa) and southern Mozambique (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The exact distribution of this species is uncertain and may be disjunct in the eastern Atlantic. While Fishbase.org lists the species as occurring in all countries of West Africa, its occurrence in many of these has not be conclusively verified and its complete distribution needs to be determined. It is however, confirmed from Morocco, Western Sahara, Senegal, Canary Islands, Madeira Islands, Mauritania, Gambia, Guinea and Guinea-Bissau (M. Ducrocq pers. comm. 06.09.03) and probably others.

In southern Africa, P. bovines is found from the southwestern Cape to Zanzibar and is apparently absent from cold waters off the western Cape coast and Namibia (Smith 1991). In Namibia it is possibly present only along the northern coast (absent in the cold upwelling waters) (Bianchi et al. 1999). Van der Elst (1988) provides the range as north of Saldhana Bay along the whole South African coast into Mozambique (as far as Maputo Bay Wallace (1967)). The species is also caught in Kenya (Ochumba 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The distribution of bull rays is not well-defined, but most observations report its range within tropical and subtropical waters of the Eastern Atlantic Ocean, between 44°N - 35°S, 19°W - 36°E, off the coast of Portugal down to the Saldanha Bay, South Africa. Bull rays have also been sighted in the Mediterranean Sea, the Black Sea, off the Canary Islands and Madeira, and in the Indian Ocean, off the coast of Kenya.

Biogeographic Regions: palearctic (Native ); ethiopian (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); mediterranean sea (Native )

  • Schwartz, J. 2011. Tail spine characteristics of stingrays (Order Myliobatiformes) found in the northeast Atlantic, Mediterranean, and Black seas. Electronic Journal of Ichthyology, 1/1: 1-9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mediterranean Sea, eastern Atlantic from Portugal to Angola; southwestern Indian Ocean: South Africa to Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Range mass: 5.3 to 116 kg.

Range length: 0.74 to 1.48 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Seck, A., Y. Diatta, A. Gueye-Ndiaye, C. Capapé. 2002. Observations on the reproductive biology of the Bull ray, Pteromylaeus bovinus (E. Geoffrey Saint-Hilare, 1879) (Chondrichthyes: Myliobatidae) from the coast of Senegal (eastern tropical Atlantic). Acta Adriatica, 43/1: 87-96.
  • Van Der Elst, R. 1993. A Guide to the Common Sea Fishes of Southern Africa. Cape Town: Struik.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1800 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

250 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 83.0 kg (Ref. 3965)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Long, flat, rounded snout like a duck's bill; head thick and pectoral disc with sharply curved, angular corners; upper or lower jaw; usually with 7 rows of flat teeth (Ref. 5578). Light brown with several pale blue-grey stripes (may be absent) dorsally, white ventrally (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found in coastal tropical and warm temperate waters, occasionally offshore. Feeds on bottom-living crustaceans and molluscs. Ovoviviparous, gestation about 6 months with 4-6 young produced.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; brackish; marine; depth range 10 - 150 m (Ref. 6808)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Little information on habitat and ecology is available from outside South Africa and most of the following comes from that country (excepting some data from Senegal and Kenya):

This tropical to warm-temperate species (Smith 1991) frequents coastal waters between the surf zone and 30 m (Van der Elst 1988) and down to 65m in the eastern Cape (Compagno et al. 1989). It tolerates greatly reduced salinities (Van der Elst 1988) and frequently enters estuaries and lagoons (Wallace 1967). It was regarded as common in the 1940 to 1960s (Wallace 1967, Smith 1991), but this needs to be re-examined.

P. bovines is not confined to the bottom, and is often seen on the surface (Van der Elst 1988), sometimes leaping from the water (Van der Elst 1988, Compagno et al. 1989, Smith 1991). It is sometimes found in small groups (Compagno et al. 1989). Between 1981 and 2001, Young (2001) found 26 occurrences of three or more bullrays caught in the same Natal Sharks Board (NSB) net installation in one or two days. Of those 10 were of mixed sex, seven comprised females only, five males only, and the rest were unknown. There was no distinct seasonal pattern, but most occurred in December, March and April.

The species is recorded throughout the year and is most common during summer months (Wallace 1967). Examining NSB net captures between 1981 and 2000, Young (2001) found that bullrays were caught throughout the year with peaks in November and December. Catch declined sharply in January then rose again in February and April. Minimum catches were observed in August and catches were generally lowest between July and September, with only 15.9% of the catch occurring during this period of the year. Significantly more males were caught during December-May, whereas the opposite was the case for females, which dominated catches in June-November. Bullray catch displayed a distinct pattern geographically related to the difference in water temperature with main catches in Richards Bay and Zinkwazi, as well as Winkelspruit and Park Rynie. Catches dropped dramatically south of Park Rynie. The sex ratio of NSB catches between 1981 and 2000 was 1:1.03 (m:f) (Young 2001).

Seck et al. 2002 found that in catches in Senegal, males were significantly more numerous than females and that females were significantly heavier than males. In their sample, both adult males and females were more abundant than juveniles. In KwaZulu-Natal, South Africa, Young (2001) examined NSB net captures between 1981 and 2000 and found that when using field length (FL, disc width), females were significantly bigger than males (median male: 81 cm FL, median female: 90 cm FL). The median for sexes combined was 83.4 cm (mode 70.1 to 80 cm FL, mean 87.7 cm FL). Lengths measured in the laboratory were generally larger than FL. The laboratory length mode was larger than FL at 100.1 to 110.0 cm. Female bullrays were larger than males, but not significantly so when using laboratory length (Young 2001).

Wallace (1967) examined 38 animals caught in the NSB nets ranging from 71.1 to 149.5 cm DW (2.72 to 56.2 kg) and three embryos (22 to 22.5 cm DW). He reported that males mature at 95 cm DW/13.6 kg and examined a gravid female of 119.4 cm DW/28.35 kg that contained three embryos (22 to 22.5 cm DW) in advanced development. Van der Elst (1988) gives a gestation period of one year after which 3 to 4 young are born, each at 50 cm DW. The smallest mature male dissected at the NSB was 104 cm DW and the smallest mature female was 105.5 cm DW (NSB, unpubl. data).

Off Senegal, Capapé et al. (1995) reports sexual maturity as 90 to 100 cm DW for females and 83 to 100 cm DW for males. Also off Senegal, Seck et al. (2002) found that adult males and females were over 82 cm DW and 90 cm DW, respectively. Eight fully developed fetuses ranged from 25 to 27 cm DW / 310 to 345 g. The smallest free-living specimen was 35.5 cm DW/460 g. Gestation lasted between five and six months. A block of oocytes appeared at the beginning of gestation and there was an inability to ovulate soon after parturition. Vitellogenesis recommenced when the embryos were practically at the end of their development. The reproductive cycle lasted one year at least. P. bovines is a pure matrotrophic species. Ovarian fecundity (6 to 8) is higher than uterine fecundity (3 to 4) and there was no relationship between size and both categories of fecundity.

According to the length-age curve of Van der Elst (1988), bullrays are ~14 years old at ~180 cm DW/100 kg. Using above local maturity lengths, both sexes mature at ~100 cm DW/10 kg, just over one year of age.

Smallest free-swimming individual: 71.1 cm DW (Wallace 1967); 35.5 cm DW/460 g (Seck et al. 2002); 30 cm NSB field length (25 cm dubious) (NSB, unpubl. data).

Largest observed embryos: 22.5 cm DW (Wallace 1967); 27 cm DW (Seck et al. 2002).

Maximum reported size: 175 cm DW (Smith 1991); 152 cm DW (Wallace 1976).

Largest observed animal: 149.5 cm DW (Wallace 1967); 115 cm DW/29.8 kg male, 148 cm DW/47.9 kg female (Seck et al. 2002); 190 cm DW (Ochumba 1988) (dubious?); 350 cm, 220 cm, 194 cm NSB field length (all dubious), 185 cm FL, 170 cm FL, 165 cm FL (78 kg) (NSB unpubl. data).

South Africa angling record: 100.2 kg.

Tagged by NSB between 1996 and 2002: 13 animals, no recaptures to date (NSB unpubl. data).

Tagged by shore anglers between 1984 and 2002: 594 animals, nine recaptures (1.01% recapture rate), which include washed up tags. Maximum distance moved: 34 km, maximum time at liberty: 1,427 days (Bullen et al. 2003).

Diet: crabs, hermit crabs, gastropod molluscs, mussels, bivalves, squid and prawns (Wallace 1967, Ochumba 1988, Compagno et al. 1989, Smith 1991).

Life history parameters
Age at maturity: ~1.2 years (male and female).
Size at maturity (disc width): 100 cm DW (male and female).
Longevity (years): Unknown.
Maximum size (disc width): 175 cm DW.
Size at birth: ~35 cm DW?
Average reproductive age (years): Unknown.
Gestation time: 5 to 6 months (Senegal); 12 months (Southern Africa).
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: Litter size: 3 to 4.
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bull rays are predominantly found in brackish coastal waters and prefer warm waters from the surf zone, which varies from one location to the next, to depths up to 150 m deep. They are commonly found in estuaries and lagoons, due to the abundance of prey in these habitats.

Range depth: surf zone to 150 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; reef ; coastal ; brackish water

Other Habitat Features: estuarine ; intertidal or littoral

  • Dulcic, J., L. Lovrenc, M. Bonaca, R. Jenko, B. Grbec, O. Guélorget, C. Capapé. 2008. The Bull ray in the Adriatic Sea. Cybium, 32/2: 119-123.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 6 - 85
  Temperature range (°C): 14.323 - 25.291
  Nitrate (umol/L): 0.756 - 10.893
  Salinity (PPS): 35.171 - 37.608
  Oxygen (ml/l): 3.953 - 5.333
  Phosphate (umol/l): 0.112 - 0.991
  Silicate (umol/l): 1.665 - 9.084

Graphical representation

Depth range (m): 6 - 85

Temperature range (°C): 14.323 - 25.291

Nitrate (umol/L): 0.756 - 10.893

Salinity (PPS): 35.171 - 37.608

Oxygen (ml/l): 3.953 - 5.333

Phosphate (umol/l): 0.112 - 0.991

Silicate (umol/l): 1.665 - 9.084
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 150m.
From 10 to 150 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on fish and zoobenthos (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Bull rays are carnivores that feed on benthic invertebrates. Important food items include brachyuran crabs, hermit crabs, prawns, and other bottom-dwelling crustaceans. They also feed on gastropod molluscs, bivalves, and small squids. A predominant prey item for the bull ray in South Africa is the sand-burrowing surf clam.

Animal Foods: mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Bull rays are shallow water predators in soft-bottomed environments of the neritic zone. They forage and feed upon benthic fish and small invertebrates, and in doing so, are important secondary and tertiary consumers within their environment. Rays excavate the soft bottoms of the sea floor while foraging for invertebrate prey. Disturbed sediments are rapidly recolonized by macrofauna and their larvae. Thus, foraging and predatory activities create habitat diversity and environmental heterogeneity.

Bull rays are host to numerous endoparasites, including trematode flatworms, monogenean flatworm, and ascarid worm.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

  • Thrush, F., R. Pridmore, J. Hewitt, V. Cummings. 1991. Impact of ray feeding disturbances on sandflat macrobenthos: Do communities dominated by polychaetes or shellfish respond differently?. Marine Ecology Progress Series, 69: 245-252. Accessed May 15, 2010 at http://www.int-res.com/articles/meps/69/m069p245.pdf.
  • Vassiliades, G. 1982. Helminthes parasites des Poissons de mer des cotes du Senegal. Bulletin de P.I.F.A.N., 44: 78-99. Accessed May 15, 2010 at http://www.sist.sn/gsdl/collect/publi/index/assoc/HASHafde/6284353f.dir/doc.pdf.
  • Zogaris, S., U. Dussling. 2010. On the occurrence of the Bull ray Pteromylaeus bovinus (Chondrichthyes: Myliobatidae) in the Amvrakikos Gulf, Greece. Mediterranean Marine Science, 11/1: 177-184.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans are a significant predator of bull rays. In addition, they are often caught in trawl nets as bycatch by shrimp fishermen, and in shark exclusion nets deployed at coastal beaches along South Africa. Natural predators include great hammerhead sharks and various pinniped species, such as South African fur seals.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most members of Chondrichthyes, bull rays have a lateral line, which they use to perceive their immediate environment. They also have nares for olfactory perception and eyes. Like other elasmobranchs, bull rays possess small electrical sensing organs, known as ampullae of Lorenzini, which form a subcutaneous electrosensory detection system. Located on the underside of the snout, the ampullae of Lorenzini detect weak electrical currents generated by the muscular contractions of their prey. Using this organ system, bull rays can detect prey buried several centimeters below the seafloor.

Communication Channels: visual ; tactile ; chemical ; electric

Perception Channels: visual ; tactile ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Gestation about 6 months; 3-7 young produced (Ref. 5578). Size at birth 45 cm WD (Ref. 6677).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Sexual development in bull rays begins when individuals reach approximately 100 cm in length. Disc-width at birth ranges from 250 mm to 270 mm. Total length at birth ranges from 530 mm to 560 mm, and weight ranges from 310 g to 345 g. Male and female development is divided into three stages: juvenile (I), subadult (II) and adult (III). For males, growth stage is noted by the shape and size of their tubercles. In Stage I, the anterior edge of the orbital area (the area above the eye) is smooth. In Stage II, tubercles form in the orbital area and slightly protrude above the eye. In Stage III, the tubercles are prominent and fully developed, with a cone-like shape. Juvenile and subadult males, stage I and II, respectively, have short, uncalcified and flexible claspers along with undeveloped, thread-like testes and genital ducts. During stage II, clasper grows quickly. As adults (stage III), claspers are elongated, calcified, and rigid. Adult males have fully developed and fully functional claspers, testes, and genital ducts. Female sexual development is marked by changes in appearance of their internal reproductive organs. During stage I, ovaries are white with microscopic oocytes and indistinct nidamental glands. During stage II, oocytes are translucent and the genital ducts are thread-like. During Stage III, the genital duct is fully developed.

Embryonic development in bull rays occurs through a reproductive process known as ovoviviparity. Eggs are fertilized internally, and embryos develop in egg cases while receiving nourishment from yolk sacs until they hatch out from the thin-walled membranes and continue development in the uterus. While in the uterus, embryos absorb nourishment through a combination of enriched nutrients supplied by mucus, fat, and protein from the uterine lining. This nutritional secretion is termed histotroph or “uterine milk,” and is ingested through a developing pup's mouth and spiracles. This type of nutrient supply facilitates the birth of large offspring. Gestation lasts about six months, with 3 to 7 pups produced in each litter.

  • Demski, L., J. Wourms. 1993. The Reproduction and Development of Sharks, Skates, Rays, and Ratfishes: Introduction, History, Overview, and Future Prospects. Dordrecht, The Netherlands: Kluwer Academic Publishers.
  • Michael, S. 1993. Reef Sharks and Rays of the World: A Guide to their Identification, Behavior, and Ecology. Annapolis, MD: Lighthouse Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information available regarding the average lifespan of bull rays. Commonly, rays grow and mature slowly, and bull rays have been known to live up to 14 years in the wild.

Range lifespan

Status: wild:
14 (high) years.

  • Last, P., J. Stevens. 2009. Sharks and Rays of Australia. Collingwood, Australia: CSIRO.
  • Lipej, L., B. Mavric, J. Dulcic. 2009. Size of the Bull ray, Pteromylaeus bovinus (Geoffroy Saint-Hilaire, 1817), from the northern Adriatic. Journal of Applied Ichthyology, 25/Supplement 1: 103-105.
  • Moyle, P., J. Cech. 2000. Fishes: An Introduction to Ichthyology. Upper Saddle River, NJ: Prentice-Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Like most elasmobranchs, bull rays are polygynandrous and mate with different partners throughout breeding season. While little documentation exists on the mating behaviors of elasmobranchs in general, a few species of rays and skates have been observed copulating in the wild. Pre-copulatory behavior occurs in many species of rays, and is illustrated by the scars and wounds left on the dorsal surface of females. In male eagle rays, precopulatory behaviors include diving upon and biting the backs of females during courtship. The male inserts a pair of modified anal fins called claspers into the female to begin coitus. Copulation may last up to several hours. It is believed that female receptivity is dependent on hormonal status.

Mating System: polygynandrous (promiscuous)

Rays in the family Myliobatidae, which includes bull rays, reproduce on a yearly cycle that ranges begins in spring and ends in fall. Gestation in bull rays lasts approximately 6 months and results in 3 to 7 pups per litter. Most individuals become sexually mature by 4 to 6 years after birth.

Breeding season: Mating season begins in spring and ends in fall.

Range number of offspring: 3 to 7.

Average gestation period: 6 months.

Range birth mass: 310 to 345 g.

Average time to independence: 0 minutes.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

Females carry developing pups and nourish them with histotroph until they are born. There is no documentation of post-birth parental care in the family Myliobatidae. Bull ray pups are born fully developed and independent, able to fend for themselves.

Parental Investment: pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Demski, L., J. Wourms. 1993. The Reproduction and Development of Sharks, Skates, Rays, and Ratfishes: Introduction, History, Overview, and Future Prospects. Dordrecht, The Netherlands: Kluwer Academic Publishers.
  • Michael, S. 1993. Reef Sharks and Rays of the World: A Guide to their Identification, Behavior, and Ecology. Annapolis, MD: Lighthouse Press.
  • Militante, C. 2010. "Pteromylaeus bovinus" (On-line). FishBase. Accessed March 18, 2011 at http://www.fishbase.org/Summary/SpeciesSummary.php?ID=5011&AT=bull+ray.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pteromylaeus bovinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACTTGATCTTTGGTGCATGAGCAGGTATAGTGGGCACTGGTCTTAGCTTACTTATTCGAACAGAATTAAGCCAACCTGGGGCTTTACTCGGTGACGATCAAATTTACAATGTTATTGTTACTGCCCACGCCTTTGTAATAATTTTCTTCATGGTCATGCCAATTATAATTGGTGGGTTCGGCAATTGACTAGTTCCACTAATAATCGGTGCTCCAGACATAGCCTTTCCGCGTATGAATAATATAAGCTTTTGACTTCTACCTCCATCTTTTCTTCTCTTATTAGCTTCAGCAGGGGTAGAAGCTGGAGCCGGAACTGGCTGAACTGTCTATCCTCCTCTGGCTGGCAATTTAGCCCATGCCGGGGCCTCTGTAGACTTAGCTATCTTCTCCTTACATTTAGCGGGGGTTTCCTCCATTCTAGCATCCATTAACTTTATCACCACGATTATTAATATAAAACCACCCGCAATTTCTCAATACCAGACACCTCTCTTTGTGTGATCGATTCTCGTTACAACTGTTCTTCTACTGCTCTCCTTACCAGTACTAGCAGCAGGCATTACCATGCTCCTTACCGACCGTAATCTCAACACAACTTTTTTCGACCCGGCAGGCGGTGGTGATCCCATCCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pteromylaeus bovinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Wintner, S.P.

Reviewer/s
Kyne, P.M., Fowler, S.L. & Compagno, L.J.V. (Shark Red List Authority)

Justification
A widespread species in the eastern Atlantic, including the Mediterranean, and the southwestern Indian, although the distribution is not completely and accurately defined. Little is known of the species? biology and ecology outside of South Africa where most of the information is historical (1940 to 1960s). In South Africa the species is taken as minor trawl bycatch and a minor bycatch of the KwaZulu-Natal shark protection nets (no significant trend in the catch rate of Natal Sharks Board (NSB) nets between 1977 and 2000). It is also caught by recreational fishers, but less frequently than other inshore elasmobranchs (e.g., Gymnura natalensis) and is generally released alive after capture. These low exploitation levels in South Africa as well as management considerations (reductions in NSB nets, reducing prawn trawl effort on the Tugela Bank, and recreational fishing restrictions) justify a Least Concern assessment for that country. However, given the historical nature of most ecological information, an update on the biology (maturity, litter size, nursery grounds etc.) and basic age and growth information is needed to reassess the regional status of this species in the near future. Elsewhere across its range, P. bovines is documented to be caught occasionally off Kenya and commonly off Senegal. Given the species? inshore occurrence, however, it is likely taken in coastal artisanal fisheries across much of its African range. Myliobatids are generally susceptible to a variety of inshore fishing gear and as such an assessment of catch levels across its range is a priority, particularly given the species? low fecundity (3 to 4 pups/litter) and the presence of generally unregulated and often intense fishing pressure on the inshore environment in some areas. At present, given the dearth of information on the species outside of South Africa, it is assessed globally as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bull ray population size and trends are unknown, making it difficult to determine the potential conservation needs of this species. Bull rays are classified as “data deficient” on the IUCN's Red List of Threatened Species, indicating there is insufficient data to adequately evaluate its conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population size and number, and the size of subpopulations, if any, are unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
South Africa:
Wallace (1967) reported that this species is seine netted in Durban and Richards Bay, South Africa. Fennessy (1994) reported that a small number (just six in a three year period) are taken by prawn trawlers operating on the Tugela Bank. The species is also sometimes caught by offshore trawlers (Compagno et al. 1989) and more recent data from prawn trawlers operating on the Tugela Bank again showed low levels of bycatch in that fishery: one animal in 46 trawls in September 2002 and six animals in 46 trawls in April/May 2003 (MCM, unpubl. data).

The species is caught by shore anglers (Van der Elst 1988, Smith 1991) but due to identification problems (species often confused with M. aquila) it is difficult to obtain accurate angling catch figures. Pradervand and Govender (2003) examined the competitive shore angling catch in the border region (Great Fish river ? Kei river) between 1982 and 1998 and combined P. bovines and M. aquila. They found that during the study period 531 animals (2.7% of the total catch, total mass 4,020.8 kg) were caught. Pradervand (2004), again combining the two species, reported 58 animals (0.3% of total catch, 419.5 kg) being caught between 1977 and 2000 during Natal Coast Anglers Union?s angling competitions in the former Transkei. Although most anglers prefer to return bullrays to the water alive (Van der Elst 1988, S. Wintner pers. obs.), release mortality is unknown and could be substantial due to the angling practices of gaffing, weighing etc. (S. Wintner pers. obs.). It is interesting to note that the recapture rate of P. bovines tagged in the South African National Tagging program is only 0.57% (Bullen et al. 2003).

Between 1981 and 2000, 798 animals (11.31% of total batoid catch), consisting mainly of juveniles, were caught in the NSB nets (Young 2001). Mean annual catch was 39.9 and mean catch rate was 0.98 (no animals/km net/yr). During the study period there was considerable variation in catch rate (0.47-1.78) and no significant trend was apparent. There was, however, a significant increasing trend in size caught. Mortality levels were moderate (44.2%, mean = 17.65 animals per year) and there was no significant trend in mortality over the time period. The highest catches occurred at Richards Bay, Zinkwazi and Durban, the highest catch rates were observed at Zinkwazi, Winkelspruit and Park Rynie. Overall, it is difficult to determine the impact of NSB nets on the population, but it is likely to be localized, as this species is not exploited anywhere else to a great extend (Young 2001).

Elsewhere:
Little information is available on catches outside of South Africa, but given the species? inshore occurrence it is likely taken in coastal artisanal fisheries across much of its range. It is known to be caught in small numbers in Kenya. Nine specimens (71?190 cm DW, 4.0?20.5 kg) were taken from commercial trawlers and local fishermen during a two year survey period (Ochumba 1988). The species is also commonly caught off the coast of Senegal (Seck et al. 2002), and as mentioned above, likely in other parts of its distribution.

Habitat degradation where human pressure on the coastal zone is high (i.e., through development, pollution etc.) is another threat likely affecting this species. Activities on the coastal zone and adjacent waterfront may impact upon important nursery area habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Artisanal fisheries operating in west and east Africa are generally unregulated and attempts to monitor and regulate fisheries in these regions would greatly improve conservation of this and other chondrichthyans. Fishery-independent surveys of this and other elasmobranchs are necessary to provide estimates of abundance and biomass.

In addition to species-specific catch details, further ecological information (including age, growth, longevity, movement patterns, habitat use, potential nursery areas, diet, reproductive studies) is required. Direct estimates of fishing and natural mortality are critical for assessing fisheries impacts on a particular species. Tagging, tracking, and genetic studies are essential for determining the population structure, movement patterns, and possible subpopulations throughout the species? range.

A recent reduction in the number of protective shark nets off KwaZulu-Natal, South Africa will help to limit catches in that region. The recreational line fishery in South Africa is managed by a bag limit of one/species/person/day for unspecified chondrichthyans, which includes P. bovines. Effort in the Tugela Bank fishery has been decreasing and as of May 2004, only three operators remain in the fishery.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA?Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the region. See Anon. (2004) for an update of progress made by nations in the range of P. bovines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Bull rays have sharp barbs on their tails, which can be troublesome for humans. Bull rays may rest on sandy bottoms within the intertidal zone, where humans may accidentally encounter them. Otherwise, there are no known adverse effects of bull rays on humans.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Although they are occasionally pursued by humans, bull rays are very rare and not commonly caught by fisherman. Otherwise, there are no known positive effects of bull rays on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bull ray

For other species that go under the same name, see bull ray (disambiguation).

The bull ray, Pteromylaeus bovinus, or duckbill ray is a large stingray of the eagle ray (Myliobatidae) family found around coasts of Europe and Africa.

Its full distribution is uncertain but it is known to be found in the Black Sea, the Mediterranean Sea,[2] the eastern Atlantic Ocean between Portugal and Guinea, the Atlantic from north of Saldanha Bay in western South Africa and round the rest of the South African coast into the Indian Ocean up to Maputo Bay in southern Mozambique, also Zanzibar and Kenya.[1][3]

It is named bull ray for the shape of its head and is sometimes called duckbill ray in South Africa[3] for its long, flat, round snout. Bull rays are often 1.5 m (4 ft 11 in) and sometimes up to 2.5 m (8 ft 2 in) in length from snout to tip of tail,[3] 1.8 m (5 ft 11 in) in width and weighing up to 100 kg (220 lb).[1] Females are larger and heavier than males.[1] It has a tail spine averaging 6.1 cm (2.4 in) in length in females and 3.2 cm (1.3 in) in males.[2]

It is found between the surf zone and depths of 65 m or more,[3] and also enters estuaries and lagoons. It frequents both the bottom and the surface and sometimes leaps from the water.[1]


References

  1. ^ a b c d e Wintner, S.P. (2005). Pteromylaeus bovinus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 6 September 2006.
  2. ^ a b Schwartz, Frank J. "Tail spine characteristics of stingrays (Order Myliobatiformes) found in the northeast Atlantic, Mediterranean, and Black Sea" in Electronic Journal of Ichthyology, 1: 1-9, July 2005
  3. ^ a b c d Froese, Rainer, and Daniel Pauly, eds. (2006). "Pteromylaeus bovinus" in FishBase. May 2006 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!