Overview

Brief Summary

Biology

These monkeys are usually found in groups, ranging in size from four to five individuals to up to 50 (4). These groups may either consist of a single male with females and their young, or have a more multimale-multifemale social system (4). Females become sexually mature at around four years of age (6) and births have been observed to peak during the fruiting season between January and August (4). A single offspring is born after a roughly six-month gestation period (6); young are carried through the treetops on their mothers' front and also by other members of the group (4). Social bonds within these douc groups are vitally important and communication takes place through a wide variety of vocal and visual signals as well as through tactile communication in the form of social grooming (4). The douc's diet is primarily composed of leaves, concentrating on young tender shoots, although fruit, buds and flowers are also consumed (4). These monkeys are arboreal, spending the majority of their time in the canopy of the forest (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

These colobine monkeys have an extremely striking appearance. At present two subspecies are recognised, the red-shanked douc (Pygathrix nemaeus nemaeus) characteristically has bright maroon legs and reddish patches around the eyes (4). In contrast, the grey-shanked douc (Pygathrix nemaeus cinerea) is less vibrant, with speckled grey legs and orange markings on the face (4). Both have dappled grey bodies, black hands and feet and white cheeks, although the cheek hairs of the red-shanked douc are much longer (4). The black-shanked douc (Pygathrix nigripes) has recently been recognised as a distinct species (1), and it is thought that the little-known P. n. cinerea may also be similarly distinct (2). The long hind limbs and tail allow these monkeys to be wonderfully agile in their treetop habitat (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in east-central Lao PDR and northern and central Viet Nam and has recently been recorded in northern Cambodia. In Viet Nam, the southern limit is Kon Tum province and the northerly limit is Nghe An Province. This species is the only one of its genus found for certain in Lao PDR (Nadler et al. 2004), ranging from Nam Kading National Biodiversity Conservation Area in Bolkhamsay in the north south to the Xe Kong River in Attapeu Province. Doucs occur south of the Xe Kong, but pelage characteristics are ambiguous making identification problematic (Timmins and Duckworth 1999). The species was recently confirmed for northern Cambodia in Voensei district, Ratanakiri through genetic analysis, however, the extent of the species distribution in Cambodia is still to be determined. It should, however, be noted that these individuals show the same pelage characteristics as those described from southernmost Lao PDR (Timmins and Duckworth 1999; B. Rawson pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Red-shanked douc langurs (Pygathrix namaeus nameaus) are found innorth and central Vietnam, east-central Cambodia and possibly in China (on the island Hainan). Another subspecies, black-shanked douc langurs (P. nemaeus nigripes) are found in southern Vietnam, southern Laos and eastern Cambodia. The subspecies P. nemaeus cinerea occurs in the central highlands of Vietnam. (Lippold, 2001a; Wisconsin Primate Research Center, 2002)

Biogeographic Regions: oriental (Native )

  • Lippold, L. 2001a. "About Doucs" (On-line). Accessed June 4, 2003 at http://www-rohan.sdsu.edu/faculty/lippold1/about_doucs.htm.
  • Wisconsin Primate Research Center, 30 October, 2002. "Douc Langur (Pygathrix nemaeus)" (On-line). Accessed June 4, 2003 at http://www.primate.wisc.edu/pin/factsheets/pygathrix_nemaeus.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Cambodia, Laos, Vietnam

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Endemic to Indochina (5), the red-shanked douc is found in central Vietnam and east-central Laos, whilst the grey-shanked douc is known only from the central highlands of Vietnam (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Douc langurs ares also known as "costumed apes" for their magnificent colors. Although all members of the species have gray bodies, white tails, and big pot-bellies, the three subspecies can be distinguished by their different color patterns.

Red-shanked douc langurs (P. nemaeus nemaeus) have black hind legs with maroon "leg warmers" from knee to ankle. The forearms are white from the elbow to the wrist. The body is gray with tri-colored agouti hairs (marked with black, white and gray). The genitals of males of this subspecies are striking, because of the white scrotum and a penis which is bright red when erect. The perineum is white, and males have patches of white on each side of their white rump patch. These white rump patches are absent on females, allowing easy differentiation of the sexes. The faces of these langurs are also conspicuously marked, with long, white hairs on the cheeks, and reddish-yellow fur on the rest of the face. There are two bands of color over the eyes, one red above one black. (Wisconsin, 2002)

Black-shanked douc langurs (P. nemaeus nigripes) have all black hind legs and gray forearms. The gray fur on the chest is lighter than it is elsewhere on the body. The area of the face is colored black, and the white hairs on the cheeks are short. Above the eyes, the two bands of color are reversed from those found in P. nemaeus nemaeus, with the black being found over the red. The perineum of this subspecies is white, and males have characteristic white rump patches, but the scrotum of males is blue. (Wisconsin, 2002)

The remaining subspecies, P. nemaeus cinerea, has mainly gray agouti fur, although the shoulders are black, and the chest, neck, tail, perineum, face, lips, and cheeks are white. The hind feet are colored black, and the forefeet, or hands, are gray with black fingers. The facial skin is goldish-brown, and there are orange markings on the nose and in between the eyes. There is also a band of orange-black color that on the neck that blends into the black on the shoulders. The band of color above the eyes is black. (Wisconsin, 2002)

The young are slightly lighter in color until they reach about 10 months of age. (Kavanagh, 1987)

Adult males weigh an average of 10.9 kg, and the smaller females average about 8.2 kg (Wisconsin, 2002). The average head and body length is 610 to 762 mm, with the tail adding an additional 558 to 762 mm (Nowak, 1999).

Pygathrix nemaeus has a sacculated stomach, which assists them in breaking down plant cellulose and obtaining nutrition from it. The dental formula is 2:1:2:3. (Wisconsin, 2002)

Average mass: females, 8.2 kg; males, 10.9 kg.

Range length: 610 to 762 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger

Average mass: 9720 g.

  • Nowak, R. 1999. Walker's Mammals of the World, Sixth Edition. Baltimore and London: The Johns Hopkins University Press.
  • Kavanagh, M. 1978. The Social Behaviour of Doucs. Primates, 19: 101-114.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in undisturbed primary and secondary evergreen and semi-evergreen broadleaf forests (Lippold 1989); it is also associated with forests on limestone (karst). It is diurnal and arboreal (Timmins and Duckworth 1999), although the animals are sometimes seen on the ground. In Lao PDR, the species was recorded at up to 1,600 m in elevation (Timmins and Duckworth 1999).

They are mainly folivorous (Nadler et al. 2003), with an estimated 75% of their diet consisting of small tender leaves (Lippold 1989). They will also eat buds, fruit, seeds, and flowers (Nadler et al. 2003). Behavioral characteristics of this species make it easy to hunt (Nadler et al. 2003). Recent fieldwork has substantiated that groups vary in size, and that this variation may be related to environmental and human disturbance, especially hunting (Lippold 1989), although this may also be attributable to a fission-fusion social structure.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Douc langurs are mostly found in tropical rainforest and monsoon forest (both primary and secondary forest). (Lippold, 1977)

Range elevation: 0 to 2000 m.

Habitat Regions: tropical

Terrestrial Biomes: rainforest

  • Lippold, L. 1977. The douc langur: A time for conservation. New York: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Doucs inhabit tropical rain and monsoon forests from sea level to altitudes of 2000 metres above sea level (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Douc langurs eat mainly leaves, which comprise about 82% of their diet. Although they prefer young, tender leaves, which are more easily digested than older, tough leaves, the digestion of these leaves is still mainly accomplished by their sacculated stomach, which helps them to break down cellulose. They also consume unripe fruits and their seeds (comprising 14% of their diet), and flowers (4% of the diet). Interestingly, douc langurs don't drink water, instead obtaining the moisture they need from the other foods they eat. (Wisconsin, 2002)

Doucs are very particular when foraging for food. Leaves and fruits are picked and eaten only after close inspection. If leaves are old or fruit is either ripe or overripe it is then discarded. (Pham, 1993)

Plants eaten include: Garcilinia multiflora leaves, Garcilinia oblongifolia leaves, Garcilinia cowa leaves, Garcilinia mangostana leaves, Ficus vasculosa leaves, Ficus chrysocarpa leaves, Ficus retusa leaves, Ficus variegata leaves, Ficus glomerata leaves, Teonogia tonkinensis leaves, Bischofia trifoliata leaves, Phyllanthus emblica leaves, Bacaurea sapida leaves, Dracontomelum duperreanum leaves, Allospondias lakonensis leaves,  Choerospondias axillaris leaves, Canarium tonkinense leaves, Canarium album leaves, Canarium nigrum leaves, Andenathera microsperma leaves, Polyalthia nemosalic leaves, Chisocheton paniculatus leaves, Anamixis grandifolia leaves, Averrhoa carambola leaves, Clausenia lancium leaves, Musa coccinea leaves, Castanea mollissma fruits, Castanopsis boisii fruits, Paasania ducampi fruits, Quercus platycalyx fruits, Madhuca pasquieri fruits, Eberhardtia tonkinensis fruits, Ficus vasculosa fruits, Ficus chrysocarpa fruits, Ficus hispida fruits, Ficus retusa fruits, Ficus variegata fruits, Ficus religiosa fruits, Ficus glomerata fruits, Tenongia tonkinensis fruits,  Broussonetia papyrifera fruits, Endosperma chinese fruits, Bischofia trifoliata fruits, Phyllanthus emblica fruits, Bacaurea sapida fruits, Dracontomelum duperreanum fruits, Allospondias lakonenis fruits, Choerospondias axillaris fruits,  Dubanga sonneratiodes fruits, Canarium tonkinense fruits, Canarium album fruits, Canarium nigrum fruits, Nephellium bassacense fruits, Nephellium chryseum fruits, Euphoea longana fruits, Eugenia brachiata fruits, Peltoforum tonkinense fruits,  Polyalthia nemosalic fruits, Chisocheton paniculatis fruits, Averrhoa carambola fruits, Dillenia heterocephala fruits, Clausenia lancium fruits, Caryota urens fruits, Gnetum montarum fruits, Musa coccinea fruits, Grewia paniculata fruits, Peltoforum tonkinense flowers, Adenantheria microsperma flowers, Averrhoa carabola flowers,  Garcilinia oblongifolia shoots, Bambusa spinosa shoots, Dendrocalmuys pattelaris shoots, Neohouzeaua dullosa shoots, Garcilinia multiflora buds, Garcilinia oblongifolia buds, Garcilinia cowa buds, Ficus hispa buds, unripe fruits, seeds and flowers.

Plant Foods: leaves; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

This monkey is primarily herbivorous. It also eats seeds, and therefore probably contributes to plant dispersal. (Pham, 1993)

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The decline in douc langurs is due primarily to hunting by humans. They are hunted both for food and for sport. The forest habitat occupied by this species also experienced intense disruption during the Vietnam war. In areas of Vietnam where defoliants were used during the war, reproduction of P. nemaeus has suffered. (Lippold, 1995; Wisconsin, 2002)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Pygathrix nemaeus is prey of:
Homo sapiens

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Douc langurs are highly social and therefore have a great repetoire of communication patterns, sharing visual, tactile, and accoustic information.

Like many other primates, doucs have a specific "play face" that they display with their mouth open and their teeth partially showing. A grimace with their teeth showing is used to initiate grooming or play. A stare, with raised-eyebrows is used as a threat, and is often responded to with a submissive grimmace. A jaw-thrusting/head shaking face is used to initiate sexual interactions, and presenting is used when a female wishes to engage in copulation.

A low-pitched growl is made to threaten other members of the group. Loud barks and quickly moving around the trees while hitting branches with both their hands and feet can be a sign of threat. (Oates, 1994) This call can also occur during feeding (Wisconsin, 2002). A squeal is often heard during agonistic encounters. A faint, bird-like call, called a twitter, is often used in response to a stare or before social grooming, and is thought to be a submissive signal, allowing another animal to approach without fear of an aggressive response (Wisconsin, 2002).

The main tactile communication channels are social grooming and play. In social grooming, parasites, dandruff flakes and other junk is removed from another monkey's fur with the hands and mouth. Females are the most active groomers, grooming each other, infants and juveniles, and adult males. Grooming is thought to reinforce social bonds between individuals. During play, these monkeys may wrestle, hit, chase, touch, pull on, and mouth one another. (Wisconsin, 2002).

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Lifespan is 24 years or more in captivity. (Lippold, 1989)

Range lifespan

Status: captivity:
24+ (high) years.

Average lifespan

Sex: male

Status: captivity:
25.0 years.

Average lifespan

Sex: male

Status: captivity:
21.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Right before mating, both the male and female give each other sexual signals. Males and females both conduct the following display, directed at members of the opposite sex: They drop their jaw forward, lift their eyebrows up then down, then shake their head. The female makes the first move, and has always been observed to initiate the copulation. She lies down on a branch and eyes her chosen mate by looking over her shoulder, a position called "presenting." The male will give a stare back then aproach the female and give a signal if he would like to move some place else to mate or stay where she has chosen. Not all times that a female presents to the male are followed by copulation. Both single and multiple matings have been reported.

(Lippold, 1989; Wisconsin, 2002)

Mating System: polygynous

Female menstrual cycles have an apprximate duration of 28 to 30 days. During estrous, the perineum of the female becomes swollen and red.

After impreganation, gestation lasts an estimated 165 to 190 days. The perineum remains swollen and red. In the wild, births peak between February and June when the fruit is plentiful. The female gives birth to one young and twins are rare. During birth, females often touch their vagina, and move between squatting and stretching positions. Females help the baby to emerge by pulling on it. The infant, in turn, helps to deliver itself by pulling on the mother's fur once its arms are free. After birth, the infant is licked clean, but in captivity, there has been no observed consumption of the afterbirth.

There is no information available on the duration of nursing. Captive females have an interbirth interval around 2 years.

Sexual maturity for females is at the age of 4 years and for males about 4 to 5 years.

(Lippold, 1989; Nowak, 1999; Wisconsin, 2002)

Breeding interval: The interbirth interval of these monkeys has not been reported.

Breeding season: Breeding occurs from August to December, with births following between February and June.

Range number of offspring: 1 to 2.

Range gestation period: 165 to 190 days.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 393.5 g.

Average number of offspring: 1.

The baby clings to its mother from the minute it is born. Infants are typically carried on the mother's belly. Females nurse their infant from both nipples. An orphaned infant was observed being fed by two females in the group and also cared for by a male.

(Lippold, 1989; Wisconsin, 2002)

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Male, Female); pre-independence (Provisioning: Female, Protecting: Male, Female); extended period of juvenile learning

  • Wisconsin Primate Research Center, 30 October, 2002. "Douc Langur (Pygathrix nemaeus)" (On-line). Accessed June 4, 2003 at http://www.primate.wisc.edu/pin/factsheets/pygathrix_nemaeus.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pygathrix nemaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0467-06|DQ355302|Pygathrix nemaeus| AACCGCTGGTTATTCTCTACAAATCACAAGGACATTGGAACTTTGTATTTATTATTTGGTGCATGAGCTGGAACCACAGGTATAGCTATA---AGTCTCCTTATTCGAGCTGAACTAGGCCAGCCCGGCAGCCTACTAGGCAAC---GACCATATTTATAATGTTATTATTACAGCCCATGCATTTGTTATAATTTTCTTCATGGTTATACCAATTATAATTGGGGGCTTCGGAAACTGACTAGTTCCCTTAATA---ATTGGCGCCCCTGACATAGCATTTCCCCGCCTAAATAATATAAGCTTCTGACTTCTCCCACCATCTTTCCTACTTCTTCTCGCATCAGCAATAGTAGAGGCTGGCGCAGGAACAGGCTGAACAGTCTATCCTCCTCTAGCAGGAAATTTTTCCCACCCAGGAGCTTCTGTAGACTTA---ACTATTTTTTCACTCCACCTAGCAGGTATTTCCTCTATCTTAGGAGCTATTAATTTTATTACTACTATTATTAACATAAAACCCCCTGCCATGTCTCAGTATCAGACACCCCTATTTGTTTGATCCGTCCTAATTACAGCAGTCTTACTGCTTCTATCCTTACCTGTATTAGCTGCG---GGCATTACAATGCTATTAACAGACCGTAATCTCAACACTACCTTCTTTGACCCCGCCGGAGGAGGAGACCCAATCTTATATCAACACTTATTCTGATTTTTCGGTCACCCTGAGGTTTATATTCTTATCTTACCTGGGTTTGGAATGATCTCCCACATTGTAACATATTATTCCGGAAAAAAG---GAACCATTCGGATATATAGGCATAGTCTGAGCTATAGTATCAATTGGGTTTTTAGGCTTTATCGTATGAGCTCACCATATATTTACTGTTGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pygathrix nemaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2cd+3cd+4cd

Version
3.1

Year Assessed
2008

Assessor/s
Ngoc Thanh, V., Lippold, L., Timmins, R.J. & Manh Ha, N.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Endangered as this species is believed to have undergone a decline of more than 50% in the last three generations (30–36 years, based on a generation length of 10–12 years), due to forest loss and hunting, and the decline is predicted to continue at the same rate or slightly higher in the next 30–36 years.

History
  • 2000
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Douc langurs have become endangered due to deforestation, hunting, and the illegal pet trade. They have also been captured and removed from the wild for use in medical research. (Lippold, 1995)

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Pygathrix nemaeus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN A1cd) on the IUCN Red List 2004 (1), and listed on Appendix I of CITES (3). Subspecies: Red-shanked douc (Pygathrix nemaeus nemaeus) classified as Endangered (EN – A1cd); grey-shanked douc (P. n. cinerea) classified as Data Deficient (DD) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population in Lao PDR is likely to be large, and is much more stable than that in Viet Nam, where after several decades of intense human pressure, populations have undergone significant declines. However, a recent survey conducted in the Son Tra Nature Reserve, revealed twelve groups of red-shanked douc langurs with at least 171 individuals at high densities (Lippold and Thanh 2008). In Lao PDR, the largest population occurs in the Nam Theun basin and surroundings, and encompasses several protected areas, representing the most important global population of the species (Timmins and Duckworth 1999).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Hunting is currently the major threat to this species, most often for subsistence use and traditional “medicine”, as well as sometimes for the international pet trade, especially from Lao PDR to Viet Nam and Thailand (Timmins and Duckworth 1999; Nadler et al. 2004). Destruction of its natural habitat is also a threat to this species; a large portion in the central part of Viet Nam has suffered from post-war human demographic explosion and extensive logging for coffee, rubber, and cashew plantations (Nadler et al. 2004), as well as wood collecting. The translocation of some three million people from the north of Viet Nam to the central highlands is likely to exacerbate rates of habitat loss through the Vietnamese range of the species. In Lao PDR and Viet Nam, general infrastructure development, and specifically the construction of the Ho Chi Minh Highway, poses a major threat to the habitat of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Doucs suffer from an extensive level of hunting, for food, live trade and medicinal properties. Despite legal protection, widespread hunting continues (7). Habitat destruction, in the form of logging, is also rife and seriously threatens the future of douc populations (7). The widespread use of defoliants and bombing during the Vietnam War also caused great habitat destruction (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I, as well as under Appendix 1B of Decree 32 (2006) in Viet Nam. Both Viet Nam and Lao PDR have legislation regarding the hunting of this species, but this is not enforced (Lippold 1989; Timmins and Duckworth 1999).

P. nemaeus has been recorded from a number of protected areas throughout its range, including Nakai Nam Theun National Biodiversity Conservation Area, Hin Namno National Biodiversity Conservation Area, Phou Xang He National Biodiversity Conservation Area, Xe Bang Nouan National Biodiversity Conservation Area, Xe Sap National Biodiversity Conservation Area (Lao PDR); Bach Ma National Park, Phong Nha-Ke Bang National Park, Pu Mat National Park (Viet Nam). The species also occurs in Viet Nam in the proposed Khe Net Nature Reserve (M. Richardson pers. comm.) and Son Tra Nature Reserve (Lippold and Thanh 2008).

There is an ongoing captive-breeding program at the Endangered Primate Rescue Centre at Cuc Phuong National Park in Viet Nam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Doucs are protected from international trade by their listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3), and are also protected by law in Vietnam (7). Populations occur within a number of reserves, such as the Bach Ma National Park and the Kong Cha Rang and Kon Khi Kinh Nature Reserves within Vietnam (4). The Douc Langur Project has been undertaking comprehensive surveys of this species in an effort to understand the distribution of populations, which is vital for any successful conservation programme (7). Their studies are also helping to uncover greater knowledge of this still poorly understood primate, such as group size and composition, and social interactions (7). The World Wildlife Fund's (WWF) Indochina Programme is also carrying out vital research into the effectiveness of national parks within Vietnam (5). The effective enforcement of existing laws and national parks will be the key to ensuring the future of this attractive and appealing primate (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Pygathris namaeus is not known to have nay negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Some langurs are collected for the pet trade, and some are hunted for food.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-shanked douc

The red-shanked douc (Pygathrix nemaeus) is a species of Old World monkey, among the most colourful of all primates. This attractive monkey is sometimes called the "costumed ape" for its extravagant appearance. From its knees to its ankles it sports maroon-red "stockings", and it appears to wear white forearm length gloves. Its attire is finished with black hands and feet. The golden face is framed by a white ruff, which is considerably fluffier in males. The eyelids are a soft powder blue. The tail is white with a triangle of white hair at the base, males of all ages have a white spot on both sides of the corners of the rump patch, females don't have these. Males have red and white genitals.

The word "douc" (pronounced 'dook') is a Vietnamese word meaning "monkey".[3] The douc is an arboreal and diurnal monkey that eats and sleeps in the trees of the forest.

Contents

Physical characteristics

Like other doucs, the red-shanked douc is a long, slender monkey. The male has an average head and body length of 61 cm (24 in), and the female averages 54.5 cm (21.5 in) long, with a tail that measures 55.8–76.2 cm (22.0–30.0 in) long.[4][5] Males weigh on average 11 kg (24 lb), and females 8.44 kilograms (18.6 lb). There is a slight difference in rump markings between genders, the male has round white spots above the triangle of white on its rump, while the female does not.[4]

Habitat and distribution

All doucs are native to Southeast Asia, specifically the countries Cambodia, China, Laos and Vietnam. The red-shanked douc is thought to be found only in north and central Vietnam and Laos. Before 1967, the douc was completely unstudied. Doucs are found in a variety of habitats: from lowland to mountainous terrain up to 2,000 m (6,600 feet), deciduous, primary and secondary rainforests, in the mid to upper levels of the canopy.

Behaviour

Doucs are, like all monkeys, social animals. They live in groups with an average size of 4 to 15, but groups of up to 50 have been recorded. A group usually consists of one or more males and approximately two females per male. Both males and females have their own hierarchies and males are dominant to females. Both males and females will eventually leave the group they were born into.

Red-shanked doucs in profile

Like all other Old World monkeys, its tail is not prehensile. It uses its tail solely for balance, and it uses its arms and legs to move through the forest along established routes. When on the move, the group is led by adult males, the juvenile males bringing up the rear and the females and infants staying safe in the middle. This douc is an aerial specialist, high up in the canopy. It is very agile and frequently makes breath-taking leaps of up to 6 meters (20 feet), leaping with its arms outstretched over its head, pushing off with its legs and landing on two feet.

When the group is untroubled, the red-shanked douc will move noisily from branch to branch through the forest, crashing through foliage, swinging under branches and leaping with two feet together, displaying its remarkable sense of balance. But when a group is disturbed, by either a predator or other dangers, it can flee soundlessly through the trees, away from danger. If it gets startled, it can give loud barks and rush around the trees slapping branches with its hands and feet. In contrast to how loud it can be when traveling, most of the time it is rather quietly eating, digesting its bulky food, dozing and grooming each other's fur.

This monkey communicates using facial expressions. It has a specific play face with the mouth open, teeth partially bared and chin thrust forward. Sometimes, it closes its eyes and paws blindly towards one another with remarkable disregard for the hazards of doing this when up a tree. Its fixed stare is a threat display. A grimace with the mouth open and the teeth exposed is a submissive gesture given in response to a stare. It is also used to initiate grooming or play. The red-shanked douc has a low-pitched growl that is given as a threat, and a short, harsh distress squeal.

This douc has been rarely observed in the wild and very little is known about its wild mating and breeding habits. Before mating, both genders give a sexual signal with the jaw forward, eyebrows raised and then lowered, and a head-shake. The female makes the first move, lying face-down on a branch, eyeing her chosen mate by looking over her shoulder. The male returns with a stare and may turn to look at another spot he considers more suitable for mating. Single-mount and multiple-mount matings have been reported.

Mating takes place from August to December. The pregnancy lasts between 165 and 190 days, resulting in the birth of a single offspring just before fruiting season of some favorite foods. Twins are very rare. The young are born with their eyes wide open and they cling to their mothers instinctively. Its body colouration is lighter than an adult's. Its short, downy grey hair has a dark stripe down the back and it has a black face and two pale stripes beneath the eyes. As it grows older, it darkens while its face lightens, achieving adult colours at 10 months. In captivity, other group members may look after an infant, and other females may even suckle it. In one study, an orphaned infant was fed by two females in the group and also cared for by a male. Females reach sexual maturity at about 4 years, while the males reach it at 4-5 years. They have a life span of about 25 years.

The main predator of the red-shanked douc is humans. It is threatened throughout its limited range by habitat destruction and hunting. Native people hunt it for food and body parts, which are used in traditional medicine. There is also a very lucrative and illegal wildlife trade for the red-shanked douc. During the Vietnam War, the douc habitat was heavily bombed and sprayed with defoliants like Agent Orange. Soldiers also used them for target practice, it is said.

Diet

A red-shanked douc at the Philadelphia Zoo

The red-shanked douc is diurnal and eats and sleeps in the trees of the forest. Its diet consists mostly of leaves high in fibers. Belonging to the subfamily Colobinae, or leaf-eating monkeys, it has a large stomach which is divided into sacs containing bacteria that breaks down the cellulose in the leaves through fermentation, giving the douc its pot-bellied look. This also makes it burp frequently from the resulting gas. It prefers to eat small, young and tender leaves, but will also eat fruit like figs, buds, petioles, flowers, bamboo shoots and seeds. It gets all the liquid and protein it needs from the food it eats and doesn't need to descend to the ground to drink. This monkey eats 50 different plant species but no animal prey. It is a messy and chaotic feeder, dropping much of its food onto the forest floor: old leaves, under-ripe or over-ripe fruits. It eats peacefully together, not quarreling over food, and has been known to share it with others. Often, it will share the same clump of foliage and may even break pieces off and hand them to each other, a type of active generosity that is rare among Old World monkeys. It does not have cheek pouches. This diet provides them with adequate protein and fluids.

Conservation status

The red-shanked douc is on the IUCN Red List of endangered species, and CITES I prohibits international trade. However, Vietnamese laws protecting the doucs have been difficult to enforce.

References

  1. ^ Groves, C. (2005). Wilson, D. E.; Reeder, D. M. eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 173. OCLC 62265494. ISBN 0-801-88221-4. http://www.bucknell.edu/msw3/browse.asp?id=12100683. 
  2. ^ Ngoc Thanh, V., Lippold, L., Timmons, R. J. & Manh Ha, N. (2008). Pygathrix nemaeus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 4 January 2009.
  3. ^ Lippold, L. K.; Brockman, D. K. (1974). "San Diego's douc langurs". Zoonooz 47 (3): 4-11. 
  4. ^ a b Gron, K. J. (2009). "Primate Factsheets: Douc langur (Pygathrix)". http://pin.primate.wisc.edu/factsheets/entry/douc_langur/taxon. Retrieved 2012-04-20. 
  5. ^ Nowak, Ronald M. (1999). Walker's Mammals of the World. 1 (6 ed.). JHU Press. ISBN 9780801857898597. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!