Articles on this page are available in 1 other language: Chinese (Simplified) (3) (learn more)

Overview

Comprehensive Description

Summary

"
Habit

Large colonies.

Habitat

Hilly and forested country-side.

Niche

Caves, caverns and crevices in rocks. Up to 338-1230m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Miniopterus schreibersii is foung in Southern Europe to Japan and the Solomon Islands, Philippines, northern Africa, Africa south of the Sahara, and northern and eastern Australia (Nowak, 1997).

Biogeographic Regions: palearctic (Native ); oriental (Native ); ethiopian (Native ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

Occurs from south-western Europe and north and west Africa through Anatolia and the Middle East to the Caucasus. In Africa it is known from records in North Africa (Morocco, Algeria, Tunisia, Libya), and west Africa (Guinea, Sierra Leone, Liberia, Nigeria, Cameroon). It is patchily distributed over its range in some huge and vulnerable colonies.

It typically occurs at altitudes of up to 1,400 m asl (commuting up to 2,600 m asl).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"
Global distribution

Southern Europe and Morocco through the Caucasus and Iran to Japan, the Indian subcontinent and east to Australia; also sub-Saharan Africa.

Known presence in Protected Areas

India Meghalaya: Siju Wildlife Sanctuary.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

北京,河北,陕西,浙江,安徽,湖南,江西,四川,贵州,云南,广西,广东,海南,福建,台湾,香港。
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 科学出版社

Supplier: EOL China Regional Center

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Large colonies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Miniopterus schreibersii has a body length of 52 to 63 mm, a tail length of 50 to 60 mm, and a forearm length of 42 to 48 mm. Its color ranges from grey to yellowish brown (Grzimek, 1990).

Miniopterus schreibersii is a medium sized bat with extremely long fingers and correspondingly broad wings (Grzimek, 1990). The second bone of the longest finger is about three times as long as the first bone. When hanging by its hind feet, this lengthened terminal part of the third finger folds back on the wing (Nowak, 1997).

The body hairs of M. schreibersii stand erect. A small tragus is visible in the ears. This species has a short snout and hairs projecting form the upper surface of the head (Grzimek, 1990). The tail of M. schreibersii is completely enclosed within the interfemoral membrane and is proportionately longer than in many other bats of the same size (Nowak, 1997).

Range mass: 8 to 11 g.

Range length: 52 to 63 mm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It forages in a variety of open and semi-open natural and artificial habitats, including suburban areas. It feeds mainly on moths, and occasionally on flies. It is a colonial species that roosts mostly in caves and mines (although it can also be found in man made tunnels, ruins and other buildings), often in large mixed colonies with other cave-dwelling bat species. Large warm caves are preferred during the nursing season. In winter it hibernates in underground sites (usually large caves with a constant microclimate). Schreiber's bat is a migrant species which changes its roosts several times during the year; long-distance movements occur occasionally (longest recorded distance 833 km: Hutterer et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Habitat

"
Habitat

Hilly and forested country-side.

Niche

Caves, caverns and crevices in rocks. Up to 338-1230m.

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

M. schreibersii has been found to roost in caves, rock clefts, culverts, caverns, and galleries (Grzimek, 1990; Nowak, 1997).

Studies of this species in India showed that the population of a given area tended to be centered in one large cave but that individuals spent part of their time in secondary roosts within a 70 km radius (Nowak, 1997).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; mountains

Other Habitat Features: caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Miniopterus schreibersii feeds on small beetles and insects. Feeding usually occurs at heights of 10 to 20 meters (Norak, 1997; Grzimek, 1990). Insects are caught by using echolocation.

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Threatened Vertebrate Associates in the Hindu Kush Alpine Meadow Ecoregion

The Hindu Kush alpine meadow has an expanse of some 10,900 square miles, situated in northeastern Afghanistan and northern Pakistan. Most of the lands lie within the Hindu Kush Mountain Range in  the altitude bracket between 3000 to 4000 meters, and correspondingly most of the precipitation is in the form of snow. This ecoregion is classified within the Montane Grasslands and Shrublands biome.

This ecoregion manifests a low rate of vertebrate endemism; however there are ten special status mammals found here, ranging from the status of Endangered to Near Threatened. The Hindu Kush alpine meadow ecoregion consists of higher elevation terrain of moderate to severe slopes. Vegetation is often sparse or almost lacking, with resulting pastoral usage of low intensity grazing of goats and sheep in some areas. Soils are largely leptosols, but many areas are covered by large expanses of rock outcrop or rocky scree. In the limited areas of arable soils, wheat is sometimes farmed, although growing of opium poppies is the only cash crop. Most of the water available for plant and animal life is supplied by snowmelt. The Helmand River, Afghanistan's largest watercourse, represents the chief catchment within the ecoregion, with headwaters rising in the Hindu Kush Range, and eventual discharge to the endorheic Sistan Basin.

Special status mammals found in the Hindu Kush alpine meadow are: the Near Threatened argali (Ovis ammon), the Vulnerable Asiatic black bear (Ursus thibetanus), the Near Threatened European otter (Lutra lutra), the Near Threatened leopard (Panthera pardus), the Endangered markhor (Capra falconeri), the Near Threatened mountain weasel (Mustela altaica), the Near Threatened Schreiber's long-fingered bat (Miniopteris schreibersi), the Endangered snow leopard (Uncia uncia), the Near Threatened striped hyena (Hyaena hyaena) and the Endangered Moschus leucogaster. Special status birds in the Hindu Kush alpine meadow are represented by the Endangered Egyptian vulture (Neophron percnopteris).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan and World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 22 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

These bats reach sexual maturity at the age of one year (Grzimek, 1990). In a study in eastern Australia by Richardson (1977) they were found to be monestrous. Mating took place in the fall (late May to early June), with fertilization and development to the blastocyst stage immediately following. Implantation was delayed until August and births occurred in December. Each female usually has one offspring (Nowak, 1997).

The young are weaned at from 7 to 9 weeks of age. After the young are weaned females are once again ready for breeding (Grzimek, 1990; Nowak, 1997).

Breeding interval: These bats apparently breed once per year.

Breeding season: Mating occurs from late May to early June.

Range number of offspring: 1 to 2.

Average gestation period: 240 days.

Range weaning age: 42 to 90 days.

Average weaning age: 52.5 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Miniopterus schreibersii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Miniopterus schreibersii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATACCTATTATTTGGTGCCTGAGCTGGAATAGTAGGCACCGCCCTCAGCCTATTAATTCGGGCCGAATTAGGTCAGCCTGGAGCCCTTCTAGGTGATGATCAGATTTATAATGTAATTGTCACCGCCCATGCTTTTGTAATAATTTTCTTCATAGTAATACCAATCATAATTGGAGGTTTCGGTAACTGACTAGTACCTTTAATGATTGGCGCTCCTGACATGGCATTTCCTCGGATAAATAACATAAGCTTTTGACTTCTTCCACCATCTTTCCTACTACTACTTGCTTCTTCAATAGTCGAAGCTGGGGCTGGTACGGGCTGAACTGTGTATCCCCCCTTAGCCGGAAACCTAGCCCACGCAGGAGCTTCCGTAGATTTAACCATTTTCTCCCTACATCTAGCAGGAGTATCCTCTATTCTAGGAGCAATTAATTTTATCACTACAATTATTAATATGAAACCCCCAGCACTATCCCAATATCAAACACCATTGTTCGTCTGATCCGTCCTAATTACTGCGGTCTTACTTTTACTATCCCTACCCGTCCTAGCTGCGGGCATTACTATACTCCTGACAGATCGAAACTTAAATACCACTTTCTTCGACCCTGCAGGAGGGGGAGATCCTATTCTGTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hutson, A.M., Aulagnier, S., Benda, P., Karataş, A., Palmeirim, J. & Paunović, M.

Reviewer/s
Hutson, A.M., Racey, P.A. (Chiroptera Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Near Threatened. Significant population declines and range contractions have been recorded in a number of range states and although it is stable in the Balkans and Turkey, overall the rate of population decline may approach 30% (almost qualifies as VU under A2a).

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Miniopterus schreibersii is on the IUCN red list for low risk, near threatened species. However, it is not on the CITES or U.S. ESA lists.

This species is mainly endangered in western Europe but possibly through out the world. Colonies that had contained thousands of individuals have disappeared. Miniopterus schreibersii is especially sensitive to disturbances and may be locally eradicated if disturbed by human workers or tourists (Nowak, 1997). Destruction of habitat is a serious threat to these animals.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In southern Europe and Asia Minor this species is widely distributed and common, but it has lost the northern parts of its range since the 1960s. Summer breeding colonies typically number 500-10,000 individuals (formerly up to 80,000 animals in Bulgaria). It winters in clusters of at least a hundred individuals (exceptionally up to 33,000 animals in Spain and Romania). Population trends vary in different parts of the range: in most of south-east Europe and Turkey it appears to be stable, whereas very significant recent declines have occurred in northern parts of the European range. In south-west Europe there have been recent mass mortality events.

Extinction has occured in Germany and Ukraine. In Switzerland the species has declined since the 1960s and it is now close to extinction, and in Austria the hibernating population has declined from 2,500 to 1-2 individuals and all maternity colonies have been lost. In Romania, half of the roosts have disappeared since the 1960s. However, no decline has been recorded in large colonies in Croatia and Bulgaria. In 2002 mass mortalities of this species were reported for populations in France, Spain and Portugal; there are also historical records for such mortalities in Italy. A herpesvirus was found but not identified as the cause of the die offs. Hundreds of individuals were found dead in spring. Mortality up to 60% in one year (2002) was reported in France (Roué and Némoz 2002), and 40% mortality occurred in Spain during the same period including 1,000 dead individuals out of 6,000 in one colony. A number of sites were subsequently deserted. Outside Europe, it is the third most common bat species in Turkey, with large colonies of thousands of individuals (A. Karatas pers. comm. 2005). Populations in the Caucasus are considered Near Threatened (K. Tsytsulina pers. comm. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not known
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In Africa there are no known threats to the species. In Europe, the disturbance and loss of underground habitats and pesticide use may threaten this species. In the Caucasus, disturbance caused by tourism in caves is a problem (K. Tsytsulina pers. comm. 2005).

The cause of recent mass mortality events is unknown. In 2002 mass mortalities of this species were reported for populations in France, Spain and Portugal. There are also historical records for such mortalities in Italy, Australia and a possible incidence in Iran. A meeting was held at the 9th European Bat Conference to discuss these incidents. Veterinary investigations in Spain did not identify any disease as the cause of the die offs, and there is increasing belief that the die offs are caused by bad weather in late winter/early spring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Human interference
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Europe, it is protected by national legislation in most range states. There are also international legal obligations for its protection through the Bonn Convention (Eurobats) and Bern Convention in parts of the range where these apply. It is included in Annex II (and IV) of the EU Habitats and Species Directive, and hence requires special measures for conservation including designation of Special Areas for Conservation. There is some habitat protection through Natura 2000, and some roosts are already protected by national legislation. There have been a number of LIFE-funded projects for this species in Spain, Italy, Romania and Germany.

The species is found in many protected areas throughout its range.

Care is required when fencing caves to minimise mortality. Further research is required into the causes of the recent mass mortality events.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Bats can be extremely benefitial to humans. They eat many of the insects and pests that plague farmers and gardeners. This helps keep insects from over populating an area and it reduces the amount damage done to crops by these insects.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Risk Statement

Habitat status

Change in quality.

Data quality

Indirect information; inferred.

Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common bent-wing bat

The common bent-wing bat, Schreibers' long-fingered bat, or Schreibers' bat (Miniopterus schreibersii) is a species of vesper bat in the family Vespertilionidae. It is a species of subtropical origin distributed throughout the southern Palearctic, Ethiopic, Oriental, and Australian regions. In Europe, it is present in the southern half from Iberia to the Caucasus, with the largest populations found in the warmer Mediterranean area.

Taxonomy[edit]

The 2 subspecies that included in M.scheibersii is now given species status. They are Miniopterus fuliginosus, and Miniopterus oceanensis.

Roosting[edit]

Colony of common bent-wing bats hanging in a cluster

The common bent-wing bat is a bat that forms major colonies and the longest period of torpor (hibernation) observed was about 12 days. These colonies can range anywhere from a few dozen or several million bats. Most of these colonies are formed in large caves or mines but they can also be found in other areas such as tunnels or ruins or other man made sites. In these roosting sites the common bent-wing bat establishes its colony in a "bell-shaped" hollow, which traps body heat and raises the temperature of the roost higher than the surrounding portions of the cave. This method of trapping warmth is used to reduce energy loss from shivering. Also, they will often enter hollows through small openings in order to better secure themselves from large predators during torpor. The common bent-wing bat migrates multiple times a year depending on weather of the roosting area; the length of these migrations can vary but the longest migration recorded was 833 km.

Threats[edit]

The common bent-wing bat is categorized as "Near Threatened" according to the International Union for Conservation of Nature. The explanation for the recent cause of these deaths is unknown but there have been many speculations as to why the mortality rate for this bat has increased. Researchers in Europe believe that the loss of underground habitats, the disturbance of their habitats, and pesticide use has caused an increase in deaths for the common bent-wing bat. In Australia researchers suspect that the high tissue levels of DDT (Dichlorodiphenyltrichloroethane) they found in the common bent-wing bat, including the young ones that had not left the maternity roosts, was the cause of these deaths.

Location[edit]

The common bent-wing bat can be found in the following countries:Afghanistan, Albania, Algeria, Armenia, Australia, Austria, Azerbaijan, Bosnia and Herzegovina, Bulgaria, Cameroon, China, Croatia, Republica Dominicana, possibly Ethiopia, France, Georgia, Gibraltar, Greece, Guinea, Hungary, India, Indonesia, Iran, Iraq, Israel, Italy, Japan, Jordan, possibly Kenya, North Korea, South Korea, Laos, Lebanon, Liberia, Libya, Republic of Macedonia, Malaysia, Malta, Montenegro, Morocco, Myanmar, Nepal, Nigeria, Pakistan, Palestine, Papua New Guinea, Philippines, Portugal, Romania, Russian Federation, San Marino, Saudi Arabia, Serbia, Sierra Leone, Slovakia, Slovenia, Solomon Islands, Spain, Sri Lanka, Switzerland, Syrian Arab Republic, Taiwan, Tajikistan, Thailand, Tunisia, Turkey, Turkmenistan, Vietnam, and Yemen.

See also[edit]

References[edit]

  • Won, Byeong-o (원병오) (2004). 한국의 포유동물 (Hangugui poyudongmul, Mammals of Korea). Seoul: Dongbang Media. ISBN 89-8457-310-8. 
  • Fenton, M. Brock. Bats. New York: Facts on File, 1992. Print
  • Kunz, Thomas H., and M. Brock Fenton. Bat Ecology. Chicago, IL: University of Chicago, 2003. Print.
  • Zubaid, Akbar, Gary F. McCracken, and Thomas H. Kunz. Functional and Evolutionary Ecology of Bats. Oxford: Oxford UP, 2006. Print.
  • Kunz, Thomas H., and Stuart Parsons. Ecological and Behavioral Methods for the Study of Bats. Baltimore: Johns Hopkins UP, 2009. Print
  • Garin, I., J. Aihartza, P. T. Agirre-Mendi, J. T. Alcalde, J. De Lucas, O. De Paz, U. Goiti, and A. Artázcoz. "Seasonal Movements of the Schreibers' Bat, Miniopterus Schreibersii, in the Northern Iberian Peninsula." Italian Journal of Zoology 75.3 (2008): 263–270. Print
  • Hutson, A.M., Aulagnier, S., Benda, P., Karataş, A., Palmeirim, J. & Paunović, M. 2008. Miniopterus schreibersii. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.1. <www.iucnredlist.org>. Downloaded on 27 September 2011
  • Rodrigues, L., and J. M. Palmeirim. "Migratory Behaviour of the Schreiber's Bat: When, Where and Why Do Cave Bats Migrate in a Mediterranean Region?" Journal of Zoology 274.2 (2008): 116–125. Print
  • http://www.iucnredlist.org/details/136514/0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!