Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

The smallest Perognathus species of all, the Silky Pocket Mouse is among the smallest rodents in North America. These Mice are most active on cool, humid nights, typically foraging for fallen seeds by sifting sand with their tiny forepaws. Sometimes they climb the stems of grasses to harvest seeds that have not yet fallen. They carry nesting materials and seeds back to the burrow in their fur-lined cheek pouches, and store seeds within the burrow. The Mice do not hibernate in winter, but remain active within their burrows, fueled by a cache of seeds. Silky Pocket Mice have not often reproduced in captivity, so knowledge about their reproductive habits is somewhat sketchy. They are known to have one or two litters a year, depending on climate and food availability. Two to six young are born in a litter, after a gestation of about four weeks.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Baird, S.F., 1855.  Characteristics of some new species of Mammalia, collected by the U.S. and Mexican Boundary Survey, Major W.H. Emory, U.S.A. Commissioner, p. 332.  Proceedings of the Academy of Natural Sciences of Philadelphia, 7:331-333.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Range Description

Central and Southern Great Plains and intermountain west in the U.S., extending southward throughout the Mexican Plateau. A disjunct population occurs in Sonora, Mexico along the Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The silky pocket mouse can be found only in western and southwestern North America. Specifically, it can be found as far west as Colorado, as far east as Texas, as far north as South Dakota, and as far south as Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southwestern and west-central Great Plains and intermountain plateaus from South Dakota, eastern Wyoming and southeastern Utah south through Arizona, Colorado, New Mexico, western Nebraska, western Kansas, western Oklahoma, north-central and western Texas, and the central plateau of Mexico to Puebla, Mexico; a disjunct population occurs along the coastal plain of the Gulf of California in Sonora; elevations of 975-2490 m (Patton, in Wilson and Reeder 1993; Best and Skupski 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Perognathus flavus is one of the smallest mice in North America. It has soft, silky fur, short ears, and a sparsely haired tail. The dorsal area is a pinkish buff, lightly mixed with black. The ventral area is pure white. They have a conspicuous postauricular patch of buffy fur, which is usually twice as large as the ear (ear is 4-7 mm). The total length is 95-118 mm, tail length is 41-58 mm, hindfoot length is 12-18 mm, and weight is 6-9 g. The main things that will differentiate this mouse from other mice is the incredibly soft fur, small size, and relatively large ear patch. Also, the interparietal bone is more narrow than the interorbital breadth of the skull.

Range mass: 6 to 9 g.

Average basal metabolic rate: 0.097 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 12 cm

Weight: 9 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 113 mm
Range: 100-130 mm

Weight:
Range: 5-10 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from allopatric P. ALTICOLUS, P. INORNATUS, and P. PARVUS in being smaller and having a relatively shorter, nonpenciled tail (Best and Skupski 1994).

Differs from P. AMPLUS in having a nonpenciled tail that is shorter, a tail that is always shorter than the head and body (Hoffmeister 1986), shorter hind feet (rarely longer than 18 mm vs. rarely shorter than 19 mm), a more conspicuous pale-colored postauricular patch, and a smaller skull (see Best and Skupski 1994).

In the Great Plains, differs from P. FASCIATUS in being smaller and in having more inflated auditory bullae, a narrower interbullar region, a shorter tail, conspicuous postauricular patches, and a shorter, broader skull (see Best and Skupski 1994).

Differs from P. FLAVESCENS in having narrower interparietals (average less than 3.6 mm vs. more than 4.0 mm in Great Plains FLAVESCENS), generally darker dorsal coloration (due to numerous black-tipped guard hairs), and larger, more contrasting postauricular patches; in Arizona, hind foot length averages 16.8 mm vs. 19.4 mm in FLAVESCENS; in New Mexico, total length usually is less than 120 mm and cranium length is less than 21 mm, vs. total length usually at least 120 mm cranium length more than 21 mm in FLAVESCENS; in Chihuahua, FLAVUS has longer ears relative to length of head and body (see Best and Skupski 1994 for further details).

Differs from P. LONGIMEMBRIS in having an absolutely and relatively shorter, nonpenciled tail, smaller average size, smaller hind feet, narrower interorbital width, wider upper molars, and shorter nasals (see Best and Skupski 1994).

Differs from sympatric P. MERRIAMI in having a shorter tail, head-body length, and hind foot; longer, softer, and laxer pelage; darker, more contrasting middorsal color with a pinkish rather than yellowish or yellowish-orange hue; larger postauricular spots; and in several cranial features; no single set of characters will distinguish all FLAVUS from all MERRIAMI, and the two species may hybridize at a few localities (see Best and Skupski 1994 for further details).

See also Williams et al. in Genoways and Brown (1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Occurs in semi-arid or arid grasslands and shrublands.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The silky pocket mouse prefers to live in low valley bottoms with good soils, where they can live among weeds and shrubs and burrow in the sand. However, they are also more tolerant to harsh habitat conditions than other pocket mice; they can be found in rocky areas and hard and stony soils.

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Sandy, sometimes rocky, soils in arid grasslands, shrublands, and pinyon-juniper woodland, in valley bottoms, hillsides, and mesas, sometimes in rather barren areas. Habitats in Arizona include plains and desert grassland, sagebrush-cactus association, grassy bajadas (often up to the oak woodland or woodland-chaparral zone), and mesquite grassland; grassy cover may be the most important element of the habitat (Hoffmeister 1986). In New Mexico, high densities occurred in areas with sparse or clumped grass cover with considerable open spaces (see Best and Skupski 1994, which see for further details on habitat in different areas). Occupies underground burrow when inactive; burrows often open at edge of rock, in crevice, or under edge of bush. Sometimes burrows into old pocket gopher mounds; may use occupied or abandoned burrows of kangaroo rats. Sometimes under surface debris during daylight hours.

Young are born in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The food habits of the silky pocket mouse are similar to other small pocket mice, mainly consuming seeds from various grasses and weeds. They also eat some green vegetation and some insects. They have been found to eat pigweed, goosefoot, Russian-thistle, prickly-pear, globemallow, sand-bur, phlox, juniper berries, gaura, and mustard seeds and grasses. The silky pocket mouse feeds primarily on stored seeds during midday to prepare energetically for foraging in early evening. They store much of the food that they find, placing it in their burrows. The silky pocket mouse is adapted to conserve water very efficiently. They rarely, or never, drink water. Instead, they obtain all of the moisture needed for survival through the breakdown of their food (metabolic water).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds almost entirely on seeds of grasses, forbs, and woody plants. Stores food in underground burrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Basically solitary and intraspecifically aggressive.

Home range generally is less than 0.3 ha and home range length averages around 60 m (Best and Skupski 1994).

Population density and age composition often fluctuate greatly among seasons and years; reported density ranges up to 53/ha but generally is not more than a few per hectare in most areas (Best and Skupski 1994).

Predators include various raptors, Carnivora, and snakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Primarily nocturnal. Apparently hibernates December-January in some areas; in Arizona and New Mexico, may exhibit torpor and/or short periods of dormancy during adverse weather, but apparently does not hibernate for extended periods (may forage above ground in subfreezing temperatures) (Hoffmeister 1986, Best and Skupski 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but they have been known to live up to 4.9 years (Philip Altman and Dorothy Dittmer 1962).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season extends from early spring to late fall, as pregnant females have been found from March through October. The gestation period is 28 days. Usually, females have one litter per year of 2-6 young, and there is occasionally a second litter in late summer. The silky pocket mouse becomes sexually active after its postjuvenile molt, which means that some of the individuals born early in the spring season are able to breed by late summer.

Average gestation period: 26 days.

Average number of offspring: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Texas, the breeding season is April-November. In Arizona, most births may occur in winter, spring, or summer (Hoffmeister 1986), but there are some pregnant females in all months. In New Mexico, most reproduction reportedly occurs April-July and September-October, with little or none in winter (see Best and Skupski 1994). Gestation lasts about 3-4 weeks. Litter size is 1-6 (average 3-4). Young are weaned in about 30 days. In New Mexico, young born in late summer do not becme sexually active until the following spring (see Best and Skupski 1994). Apparently 1 litter/year in much of Great Plains, 2+/year in Texas. Most individuals live only a few months; few live more than 20 months; a very few may live as long as three years (see Best and Skupski 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Perognathus flavus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2126-09|EU107516|Perognathus flavus| AATCGTTGACTCTTCTCAACTAACCACAAAGACATTGGTACACTTTACCTAATATTCGGAGCTTGAGCCGGCATGGTAGGGACTGGACTC---AGCATTCTCATCCGAGCTGAACTAGGCCAGCCCGGGGCCTTATTAGGGGAT---GATCAGATTTACAATGTAGTTGTAACCGCTCATGCATTTGTTATAATTTTCTTTATGGTCATGCCAATTATGATTGGAGGTTTTGGAAATTGATTGGTGCCTCTGATG---ATTGGAGCCCCTGACATAGCCTTTCCTCGAATAAATAATATGAGCTTCTGGCTTCTCCCACCGTCCTTCCTACTCTTACTGGCATCATCAATAGTAGAGGCTGGAGCAGGAACAGGCTGAACAGTATACCCACCGCTGGCCGGTAATTTAGCTCATGCCGGGGCCTCTGTGGACCTA---ACCATCTTCTCTCTCCACTTAGCAGGTGTATCTTCAATTCTAGGAGCCATTAATTTTATTACTACTATTATTAATATGAAACCGCCCGCAGTTTCCCAATACCAAACTCCTTTATTTGTCTGATCAGTCCTAATCACAGCTGTATTACTACTTCTATCTCTCCCTGTCCTGGCTGCT---GGTATCACAATGCTTCTAACAGATCGGAACCTAAATACAACATTTTTTGACCCAGCAGGTGGGGGAGACCCTATCCTGTACCAACACCTATTCTGATTTTTCGGACACCCAGAAGTCTACATTCTTATTCTTCCTGGCTTCGGAATTATTTCACATATTGTGACCTTTTACTCGGGCAAAAAA---GAGCCATTTGGCTATATAGGAATAGTTTGAGCTATAATATCAATTGGGTTTCTGGGCTTTATCGTATGAGCTCATCATATATTTACTGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Perognathus flavus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T.

Reviewer/s
McKnight, M. (Global Mammal Assessment Team) & Amori, G. (Small Nonvolant Mammal Red List Authority)

Justification
This species is listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

While there is no special status assigned to the silky pocket mouse, there is an increasing concern for particular subspecies. Certain Californian subspecies (P. longimembris brevinasus, P. inornatus psammophilus, p. alticola alticola, P. longimembris pacificus) are losing a vast amount of habitat due to construction and urbanization.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

"The subspecies P. flavus goodpasteri (Goodpaster's silky pocket mouse) is Near Threatened."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is abundant and common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No known major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures specific to this species. However, there are several protected areas within its range.

One subspecies P. f. goodpastori is considered threatened in Arizona due to its very isolated and restricted range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Silky Pocket Mouse

The Silky Pocket Mouse (Perognathus flavus) is a species of rodent in the Heteromyidae family. It is found in Mexico and the United States.

References

  1. ^ Linzey, A.V., Timm, R., Álvarez-Castañeda, S.T., Castro-Arellano, I. & Lacher, T. (2008). Perognathus flavus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 22 January 2009. Database entry includes a brief justification of why this species is of least concern


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Names and Taxonomy

Taxonomy

Comments: There has been uncertainty as to whether subspecies merriami is specifically distinct from P. flavus. Based on morphological evidence, Wilson (1973) concluded that P. flavus merriami and P. f. gilvus probably interbreed and intergrade in eastern New Mexico and western Texas. However, an electrophoretic analysis by Lee and Engstrom (1991) indicated that introgression between flavus and merriami in western Texas and eastern New Mexico is limited; the two taxa exhibit substantial sympatry and appear to interact as distinct species. Jones et al. (1992), Baker et al. (2003), and Patton (in Wilson and Reeder 1993, 2005) accepted merriami as a distinct species. In a phylogenetic analysis based on molecular data, Riddle (1995) found that Chihuahuan P. flavus grouped with P. merriami relative to P. flavus of the Southern Intermountain Basins.

See Best (1994) for a key to the species of Perognathus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!