Overview

Comprehensive Description

Description

Pink color.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Occurs in the western part of the Barents sea.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Eyes transformed into two immobile plates with crests on the front edge, lack ommatidia. Telson is tongue-shaped, the back edge is armed with numerous spines. Pink color.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Up to 18 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 183 - 1939
  Temperature range (°C): 2.051 - 10.585
  Nitrate (umol/L): 14.225 - 43.662
  Salinity (PPS): 34.177 - 35.590
  Oxygen (ml/l): 0.552 - 6.147
  Phosphate (umol/l): 0.873 - 3.203
  Silicate (umol/l): 6.575 - 169.499

Graphical representation

Depth range (m): 183 - 1939

Temperature range (°C): 2.051 - 10.585

Nitrate (umol/L): 14.225 - 43.662

Salinity (PPS): 34.177 - 35.590

Oxygen (ml/l): 0.552 - 6.147

Phosphate (umol/l): 0.873 - 3.203

Silicate (umol/l): 6.575 - 169.499
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Bathypelagic species.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblyops abbreviata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGAGTGGGATCATCCGCCTTGAGCTAGGCCAGCCTGGGGGTATTCTTCAAAAC---TCACAGCTCTACAATGTAATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATGGTAATGCCTATTATAATTGGTGGTTTCGGAAACTGGTTAGTACCCCTAATAATTGGAGCGCCTGATATGGCATTCCCCCGTATAAATAACATGAGCTTTTGACTCCTCCCCCCTTCTCTACTTCTACTTCTTTTAAGTGGGCTGGTCGAAAGGGGTGTAGGTACAGGTTGGACGCTATACCCCCCTCTGTCAGCAAATGTAGCCCACAGCGGTCCTTCTGTTGACCTCGCAATCTTCAGTTTACACCTAGCCGGAGCCTCTTCAATCCTAGGCGCTGTGAACTTCCTCGCTACAATCTTAAACATGAAGATACCAGGCATAAGTATAGATAAAATACCACTTCTTGTCTGATCTATTTTCATCACCGCAGGCCTCCTTCTACTATCCCTCCCCGTTTTAGCCGGCGCTATTACTATACTTTTAACAGACCGAAACCTCAATACATCTTTTTTTGACCCGGTCGGGGGCGGTGACCCTATCCTATAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amblyops abbreviata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!