Overview

Distribution

White-faced sakis (Pithecia pithecia) are located in Brazil, and remote parts of Venezuela. Their range also encompasses most of French Guiana, Guyana and Suriname. They live along the Cuyuni river basin, east of the Caroni River, and south of the Orinoco River.

Biogeographic Regions: neotropical (Native )

  • Veiga, L., L. Marsh. 2008. "IUCN Red List of Threatened Species" (On-line). Pithecia pithecia. Accessed February 23, 2012 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Pithecia pithecia is distributed throughout the northern Amazon basin (Hershkovitz 1987). In Venezuela, it is restricted to the north-eastern Bolívar State and the southern part of the Delta Amacuro State. This species is located east of the lower Caroní River, south of the lower Orinoco River, and along the Cuyuní river basin.

The exact range limits of the two subspecies remain unclear. According to Hershkovitz (1987), Pithecia p. pithecia occurs in the Guyanas and Pithecia p. chrysocephala in Brazil; however, the former has been confirmed in the state of Amapá and the north of Pará, which means the range of Pithecia p. chrysocephala is reduced to the area between the Rios Negro and Rio Nhamundá (Jose Silva Jr. pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

White-faced sakis exhibit sexual dimorphism, with larger males, and sexual dichromatism. Males have a black coat with white fur that surrounds their face. Female sakis have a shorter, brownish grey coat with two vertical lines from their eyes to their nose. Females may also have orange brown colored fur that emerges around the chest area and continues down to their abdomen. At birth males and adult females are very similar in appearance. A gradual color change over 3.5 to 4 years occurs, in which male sakis become all black with bright white faces.  Sakis have long bushy tails, which are used for balance while jumping from tree to tree. The tails are not used for grasping objects or branches. Average adult mass is 1.8 kg; however, a slight sexual dimorphism separates males (2.38 kg) from females (1.76 kg).

Average mass: 1.871 kg.

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful

Other Physical Features: endothermic ; bilateral symmetry

  • Fleagle, J., D. Meldrum. 1988. Locomotor behavior and skeletal morphology of two sympatric Pitheciine monkeys, Pithecia pithecia and Chiropotes satanas. American Journal of Primatology, 16/3: 227-249.
  • Norconk, M. 2006. Long-term study of group dynamics and female reproduction in Venezuelan Pithecia pithecia. International Journal of Primatology, 27/3: 653-674.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

White-faced sakis are arboreal and live in both upland and lowland rainforests. Although they can inhabit very wet and very dry forests, they prefer areas with an abundance of fruit trees and watering holes.  This species is most common at canopy heights of 15 to 25 m. They will also spend time foraging on the ground and at low levels in the understory foliage (3 to 15 m). Overnight sleeping areas typically are larger trees in the canopy with a wealth of foliage for cover.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

  • Anzelc, A. 2009. The Foraging and Travel Patterns of White-Faced Sakis in Brownsberg Nature Park, Suriname: Preliminary Evidence for Goal-Directed Foraging Behavior. Kent, Ohio: Kent State University, Master's thesis, 194 oo.. Accessed April 24, 2012 at http://www.personal.kent.edu/~mnorconk/pdfs/Anzelc-thesis-7-20-09b.pdf.
  • Cunningham, E., C. Janson. 2007. Integrating information about location and value of resources by white-faced saki monkeys (Pithecia pithecia). Animal Cognition, 10/3: 293-304.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Pithecia pithecia occurs in moist lowland and submontane rainforest, and swamp forests of the mid-delta.

Sakis are specialized morphologically for seed predation. The diet of a group of Pithecia, p. pithecia comprised seeds (61%), fleshy fruit (28%), young leaves (7%), insects (2%) and flowers (2%) (Kinzey and Norconk 1993; Norconk 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Sakis eat the seeds of fruiting bodies. They spend 95 to 99% of total consumption time eating and breaking open the seeds. Year-round, they prefer to eat seeds 38 to 88% of the time. Leaves are also an important source of food. They eat the young leaves of plants during the dry season when fruits are not plentiful. Given this diet, their intake of fats are extremely high, but their intake of proteins are low. On occasion, they have been known to consume insects and flowers when fruit is scarce.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Folivore , Frugivore , Granivore )

  • Norconk, M., N. Conklin-Brittain. 2004. Variation on frugivory: The diet of Venezuelan white-faced Sakis. Internation Journal of Primatology, 25/1: 1-26.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Saki have parasites typical to that of new world monkeys and non-human primates. For example a common parasites are roundworms (Pterygodermatites nycticebi). Heartworms (Dirofilaria immitis) are present in this species, too. They can also get diseases such as diabetes and the Mayaro virus (which is found in mammals that live in trees).

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Gamble, K., J. Fried, G. Rubin. 1998. Presumptive dirofilariasis in a pale-headed saki monkey (Pithecia pithecia). Journal of Zoo and Wildlife Medicine, 29/1: 50-54.
  • Thoisy, B., J. Gardon, R. Salas, J. Morvan, M. Kazanji. 2003. Mayaro virus in wild mammals, French Guiana. Emerging Infectious Diseases, 9/10: 1326-1329.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

When a terrestrial predator, such as red-tailed boas, are near sakis will first make an alarm call. Then they will group together and mob the predator in hopes of driving it away. Other terrestrial predators include a weasel called tayras, jaguars, green anacondas, and ocelots. Their biggest threats are avian predators. Because of their size, sakis are easy prey to the harpy eagle, which are known to attack large primates. A study reported more alarm calls when there is an avian threat, such as an eagle or vulture. When a bird of prey is spotted sakis make the alarm call, which is echoed by group member, and then they stay completely motionless. After time has elapsed, sakis might slip out undetected, heading for lowest parts of the canopy. They try to remain as concealed as possible in the canopy.

Known Predators:

Anti-predator Adaptations: aposematic

  • Norconk, M., T. Gleason. 2002. Predation risk and antipredator adaptations in white-faced sakis, Pithecia pithecia. Pp. 169-183 in L Miller, ed. Eat or be eaten: predator sensitive foraging among primates. Cambridge, United Kingdom: Press Syndicate of the University of Cambridge.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Sakis live in small groups ranging from 2 to 4 individuals; however larger groups of 6 or more have been reported and may include more than one adult breeding male or female. To establish territory they have loud vocal calls usually performed in duets of monogamous males and females. These duets strengthens their courtship bond. They also socialize by grooming on one another.  White-faced sakis will scent-mark an area. Males rub their chests on trees. They usually choose trees with edible fruit to excite females and to try to stimulate courtship behavior during breeding season.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: duets ; pheromones ; scent marks ; vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

  • Lehman, S., W. Prince, M. Mayor. 2001. Variations in group size in white-faced sakis (Pithecia pithecia): Evidence for monogamy or seasonal congregations. Neotropical Primates, 9/3: 96-100.
  • Setz, E., D. Gaspar. 1997. Scent-marking behaviour in free-ranging golden-faced saki monkeys, Pithecia pithecia chrysocephala: Sex differences and context. Journal of Zoology, 241/3: 603-611.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In the wild, white-faced sakis have been known to live about 15 years. One wild-caught saki in captivity lived to the age of 36, spending over 28 of those years in captivity.

Range lifespan

Status: captivity:
36 (high) years.

Average lifespan

Status: wild:
15 years.

  • de Magalhaes, J., J. Costa. 2009. A database of vertebrate longevity records and their relation to other life-history traits. Journal of Evolutionary Biology, 22/8: 1770-1774.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36 years (captivity) Observations: One wild born male lived 28.2 years in captivity. He was about 36 years old when he died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sakis are known to be monogamous in captivity (zoo environments) although Waters (1995) indicates there have been exceptions in the wild. Anzelc (2009) suggests that monogamy in the wild is less common than expected, and is less common when groups are larger than 2 to 3 individuals. Groups of 4 to 6 are not uncommon, and can include more than one adult breeding male or female. This suggests polygamous or polyandrous mating system, depending on the breakdown of adults in the group.

Mating System: monogamous ; polyandrous ; polygynous

Males and females live in small groups. Despite practicing monogamy in zoos, a study of wild sakis in Venezuela found that some sakis were not monogamous. In wild groups, males will make calls to the females during mating season instead of as an alarm call. Males reach sexual maturity in approximately 32 months. Females are about the same age, but can take several months more. It isn't until the females' ovarian cycle is regular that they are determined sexually mature.  Gestation periods for sakis average 146 days, and females bear 1 offspring at a time. Saki siblings from the previous year or 2 may help care for a newborn saki.

Breeding interval: Sakis breed once per year.

Breeding season: Sakis breed in the spring.

Average number of offspring: 1.

Average gestation period: 146 days.

Average age at sexual or reproductive maturity (male): 32 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Females sakis are the predominant caretakers. Infants stay attached to their mother's thigh from birth to 1 month. From age one to four months, the young shift to a dorsal position where they can achieve greater mobility. The mothers carry their infants for the first 3 months. After the infant is around the age of 5 months, the mother will stop carrying it. They feed, protect, and nurture young until they are ready to be on their own. However, infants observe one birthing event prior to leaving their family group.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Anzelc, A. 2009. The Foraging and Travel Patterns of White-Faced Sakis in Brownsberg Nature Park, Suriname: Preliminary Evidence for Goal-Directed Foraging Behavior. Kent, Ohio: Kent State University, Master's thesis, 194 oo.. Accessed April 24, 2012 at http://www.personal.kent.edu/~mnorconk/pdfs/Anzelc-thesis-7-20-09b.pdf.
  • Norconk, M. 2006. Long-term study of group dynamics and female reproduction in Venezuelan Pithecia pithecia. International Journal of Primatology, 27/3: 653-674.
  • Waters, S. 1995. A review of social parameters which influence breeding Pithecia pithecia in white-faced saki in captivity. International Zoo Yearbook, 34/1: 147-153.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pithecia pithecia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTATACCTATTATTTGGTGCATGAGCAGGAGCAGTAGGAACTGCCCTAAGCCTTCTTATCCGAGCGGAGCTAGGCCAACCGGGAAGCCTCATAGAAGATGACCATGTCTACAACGTTATCGTCACCTCCCATGCATTTATTATAATCTTTTTTATAGTCATGCCTATTATAATCGGAGGATTTGGAAACTGACTCGTCCCGCTAATAATTGGTGCCCCTGACATAGCGTTTCCCCGAATAAACAACATAAGCTTTTGACTTCTCCCTCCATCACTCCTTCTTCTTCTAGCATCATCAACCCTAGAGGCAGGCGCTGGAACCGGTTGAACAGTTTACCCGCCACTAGCAGGAAACATATCGCACCCAGGAGCCTCTGTAGACCTAACTATTTTTTCACTCCACTTGGCAGGCATTTCCTCTATCCTAGGAGCAATTAACTTTATTACAACAATTATTAACATGAAACCCCCAGCAATAACCCAATACCAAACACCCTTATTTGTCTGATCTGTTCTAATTACAGCTGTTCTCCTCCTCCTCTCCCTCCCAGTCCTAGCTGCAGGAATTACAATATTGTTAACTGACCGCAACCTTAATACTACCTTCTTTGACCCCGCTGGTGGCGGAGATCCAATTCTATACCAACATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pithecia pithecia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species is not currently listed by IUCN and is of little concern for conservation managers. However, due to habitat destruction and the pet trade, this status could change. It is listed in Appendix II of CITES, indicating that the species could become threatened if trade or import and/or export is not regulated.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Veiga, L.M. & Marsh, L.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern given its relatively wide distribution, presence in a number of protected areas, and lack of any apparent major threats.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Vié et al. (2001) recorded a population density 0.64 individuals/km² for the nominate subspecies.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no obvious major threats to the species at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in a number of protected areas. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Sakis may carry diseases which can be transferred to humans including the hepatitis virus and the naturally occurring herpes virsus (HSV-1). However, they are not a major disease transmitter.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

  • Schrenzel, M., K. Osborn, A. Shima, R. Klieforth, G. Maalouf. 2003. Naturally occuring fatal herpes simplex virus 1 infection in a family of white-faced saki monkeys (Pithecia pithecia pithecia). Journal of Medical Primatology, 32/1: 7-14.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

White-faced sakis are charaismatic organisms that attract high interest in zoos, however they are recently being exploited for their charisma. There is a market for these monkeys as pets, which is detrimental to the sakis. They are hunted as a source of food by locals. This hurts the population of sakis, because they don't reproduce quickly enough to replace the individuals killed and captured.

Positive Impacts: pet trade ; food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-faced saki

The white-faced saki (Pithecia pithecia), also known as the Guianan saki and the golden-faced saki, is a species of saki monkey, a type of New World monkey, found in Brazil, French Guiana, Guyana, Suriname and Venezuela. This species lives in the understory and lower canopy of the forest, feeding mostly on fruits, but also eating nuts, seeds, and insects.

There are two recognized subspecies of this monkey:

Reproduction[edit]

Female (left) and male (right) Pithecia pithecia, illustrating sexual dimorphism in coat coloration.

In captivity, female white-faced sakis experience ovarian cycles of approximately 17 days, and a gestational period of 20–21 weeks. Following birth, the mother undergoes a period of lactationally-induced fertility lasting 23 weeks, on average.[3]

Sakis of the Pithecia pithecia species display noticeable sexual dichromism in their coloration. Females have shorter hair than males, with brownish-grey fur and white or pale brown stripes around the corners of the nose and mouth. Males, on the other hand, have blacker fur, with a reddish-white forehead, face, and throat.[4]

Behavior[edit]

A pair often mates for life. They are very devoted and will strengthen their bond by grooming one another.

References[edit]

  1. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 148. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Veiga, L. M. & Marsh, L. (2008). Pithecia pithecia. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 3 January 2009.
  3. ^ Savage, A., et al. (1995). Selected aspects of female white-faced saki (Pithecia pithecia) reproductive biology in captivity. Zoo Biology, 14(5), 441–452. Retrieved 8 July 2008, from Wiley InterScience Journals database. doi:10.1002/zoo.1430140506.
  4. ^ Sakis Pithecia. (23 Feb 2004). Retrieved 8 July 2008, from Mark V. Flinn, Dept. of Anthropology, University of Missouri-Columbia
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!