Overview

Distribution

Range Description

Pithecia pithecia is distributed throughout the northern Amazon basin (Hershkovitz 1987). In Venezuela, it is restricted to the north-eastern Bolívar State and the southern part of the Delta Amacuro State. This species is located east of the lower Caroní River, south of the lower Orinoco River, and along the Cuyuní river basin.

The exact range limits of the two subspecies remain unclear. According to Hershkovitz (1987), Pithecia p. pithecia occurs in the Guyanas and Pithecia p. chrysocephala in Brazil; however, the former has been confirmed in the state of Amapá and the north of Pará, which means the range of Pithecia p. chrysocephala is reduced to the area between the Rios Negro and Rio Nhamundá (Jose Silva Jr. pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Pithecia pithecia occurs in moist lowland and submontane rainforest, and swamp forests of the mid-delta.

Sakis are specialized morphologically for seed predation. The diet of a group of Pithecia, p. pithecia comprised seeds (61%), fleshy fruit (28%), young leaves (7%), insects (2%) and flowers (2%) (Kinzey and Norconk 1993; Norconk 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 36 years (captivity) Observations: One wild born male lived 28.2 years in captivity. He was about 36 years old when he died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pithecia pithecia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACTATACCTATTATTTGGTGCATGAGCAGGAGCAGTAGGAACTGCCCTAAGCCTTCTTATCCGAGCGGAGCTAGGCCAACCGGGAAGCCTCATAGAAGATGACCATGTCTACAACGTTATCGTCACCTCCCATGCATTTATTATAATCTTTTTTATAGTCATGCCTATTATAATCGGAGGATTTGGAAACTGACTCGTCCCGCTAATAATTGGTGCCCCTGACATAGCGTTTCCCCGAATAAACAACATAAGCTTTTGACTTCTCCCTCCATCACTCCTTCTTCTTCTAGCATCATCAACCCTAGAGGCAGGCGCTGGAACCGGTTGAACAGTTTACCCGCCACTAGCAGGAAACATATCGCACCCAGGAGCCTCTGTAGACCTAACTATTTTTTCACTCCACTTGGCAGGCATTTCCTCTATCCTAGGAGCAATTAACTTTATTACAACAATTATTAACATGAAACCCCCAGCAATAACCCAATACCAAACACCCTTATTTGTCTGATCTGTTCTAATTACAGCTGTTCTCCTCCTCCTCTCCCTCCCAGTCCTAGCTGCAGGAATTACAATATTGTTAACTGACCGCAACCTTAATACTACCTTCTTTGACCCCGCTGGTGGCGGAGATCCAATTCTATACCAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pithecia pithecia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Veiga, L.M. & Marsh, L.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
This species is listed as Least Concern given its relatively wide distribution, presence in a number of protected areas, and lack of any apparent major threats.

History
  • 2003
    Least Concern
    (IUCN 2003)
  • 2003
    Least Concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Vié et al. (2001) recorded a population density 0.64 individuals/km² for the nominate subspecies.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no obvious major threats to the species at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It occurs in a number of protected areas. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-faced saki

The white-faced saki (Pithecia pithecia), also known as the Guianan saki and the golden-faced saki, is a species of saki monkey, a type of New World monkey, found in Brazil, French Guiana, Guyana, Suriname and Venezuela. This species lives in the understory and lower canopy of the forest, feeding mostly on fruits, but also eating nuts, seeds, and insects.

There are two recognized subspecies of this monkey:

Reproduction[edit]

Female (left) and male (right) Pithecia pithecia, illustrating sexual dimorphism in coat coloration.

In captivity, female white-faced sakis experience ovarian cycles of approximately 17 days, and a gestational period of 20–21 weeks. Following birth, the mother undergoes a period of lactationally-induced fertility lasting 23 weeks, on average.[3]

Sakis of the Pithecia pithecia species display noticeable sexual dichromism in their coloration. Females have shorter hair than males, with brownish-grey fur and white or pale brown stripes around the corners of the nose and mouth. Males, on the other hand, have blacker fur, with a reddish-white forehead, face, and throat.[4]

Behavior[edit]

A pair often mates for life. They are very devoted and will strengthen their bond by grooming one another.

References[edit]

  1. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 148. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Veiga, L. M. & Marsh, L. (2008). Pithecia pithecia. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 3 January 2009.
  3. ^ Savage, A., et al. (1995). Selected aspects of female white-faced saki (Pithecia pithecia) reproductive biology in captivity. Zoo Biology, 14(5), 441–452. Retrieved 8 July 2008, from Wiley InterScience Journals database. doi:10.1002/zoo.1430140506.
  4. ^ Sakis Pithecia. (23 Feb 2004). Retrieved 8 July 2008, from Mark V. Flinn, Dept. of Anthropology, University of Missouri-Columbia
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!