Overview

Brief Summary

Biology

Tree-dwelling olive colobus live in groups of 5 to 20 individuals with around half containing one adult male with several females and their young (2), and the remaining groups having multiple breeding males (6). Members of a group communicate infrequently with very quiet chirping or burring calls (2). Little is known about reproduction in the olive colobus, but it is believed to be the only Old World monkey in which the female carries the newborn in her mouth while she travels for the first month of life (5) (7). As the infant grows, it may wrap itself around the female's neck or cling to her body as she moves through the forest (2). The olive colobus is a shy and retiring monkey that prefers to move through dense growth below ten metres, but climbs higher when feeding amongst the protection of other species (2) (7), particularly Diana monkeys (Cercopithecus diana), with which they have a strong tendency to associate (8), as well as lesser spot-nosed guenons (Cercopithecus petaurista) and king colobus (Colobus polykomos) (5). By foraging with other primate species, the olive colobus benefits from extra eyes and ears to stay alert for predators (8). Males are also believed to use these associations to obtain mating partners; the Diana monkeys are a resource which the males can expect female olive colobus to visit (6). If a predator is spotted, the primary response of the timid olive colobus is to move in to dense foliage and freeze in a hunched or crouched position (2). The diet of the olive colobus is dominated by young leaves and flowers, with one study showing 27 percent of their diet acquired from lianas, in the tangles of which they spend much of their time (9). Fruit and seeds are also eaten, with the quantities varying seasonally (2), but mature leaves are rarely ingested (9). They eat the food directly off the plant using their mouth, and do not pick it by hand (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The olive colobus has the distinction of being the smallest colobus monkey (2), a group of primates that primarily consume leaves and possess an unusual stomach that enables them to digest this plant matter efficiently (4). The olive colobus has greenish-olive fur graduating to brown on the back, and dull grey undersides. The small, rounded head has a short, grey crest running down the crown with a swirl of light grey hair on each side of the forehead. A dull white ruff frames the hairless dark face (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Procolobus verus is found on the western coast of Africa, from Sierra Leone to Tongo. There is also an isolated population in eastern Nigeria.

(Burton and Pearson, 1988; Oates and Whitesides, 1990; Flannery, 2000; Nowak, 1997)

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

The Olive Colobus is confined to the forests of west Africa, and is discontinuously distributed from southern Sierra Leone and Guinea to south-east Nigeria. Oates' (1982) map shows a more or less continuous range from Sierra Leone to Ghana, extending just east of the Volta River, and again in Nigeria on the south bank of the Benue River just above its confluence with the Niger. He considered the distributional gap to be real rather than an artefact of collecting or observation (Groves 2001). In a few localities (e.g., Tai forest, Côte d'Ivoire), it is only locally distributed, but numerous. In a recent survey of Bénin and Togo, Campbell et al. (2008) found the Olive Colobus in 13 of the 26 localities surveyed in Bénin; no sightings were made in Togo by Campbell's team, although it was reported by hunters at one locality (see Campbell et al. 2008 for more details).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The olive colobus occurs from southern Sierra Leone to Ghana, just east of the Volta River, and also in Nigeria, on the south bank of the River Benue (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Procolobus verus is the smallest and the most drab colored of all African colobus monkeys, bearing olive colored hair with a tinge of brown on top and grayish underparts. Weights range from 2 to 4.5 kg, and body lengths of 90 to 430 mm are reported. Procolobus verus has a similar body structure to black and white colobus monkeys, but olive colobus monkeys have a small crest on top of the head and the most reduced thumb and largest feet of any colobine. Males are equal in size to females with relatively larger canines than females.

Procolobus verus possesses six cusps on the lower third molars.

(Burton and Pearson, 1988; Nowak, 1997)

Range mass: 2.2 to 4.5 kg.

Range length: 90 to 430 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits the high forest zone of West Africa and can be particularly common in areas of secondary growth within high forest, in swamp and palm forests. Olive Colobus are cryptic in colouration and behaviour, residing in small groups, usually as part of a large polyspecific association, and mainly occupying the lower and middle dense vegetation strata (Oates 1988; Campbell et al. 2008). It is found extensively in farmbush in parts of its range, and it appears that they can survive in small and degraded forest fragments. It prefers dense growth below 10 m, but may ascend to 30 m or even the canopy when feeding in the company of other species. The diet of the Olive Colobus is mainly comprised of young leaves, buds, and flowers (70%), as well as only 10% mature leaves. There is a strong preference for unripe fruits, although the quantities of fruits and seeds taken vary according to the season. It is almost always found in close association with other cercopithecus monkeys (diana, mona, petaurista, cambelli). This species is almost exclusively arboreal, and is very shy.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Niger Coastal Delta Habitat

The Niger Coastal Delta is an enormous classic distributary system located in West Africa, which stretches more than 300 kilometres wide and serves to capture most of the heavy silt load carried by the Niger River. The peak discharge at the mouth is around 21,800 cubic metres per second in mid-October. The Niger Delta coastal region is arguably the wettest place in Africa with an annual rainfall of over 4000 millimetres. Vertebrate species richness is relatively high in the Niger Delta, although vertebrate endemism is quite low. The Niger Delta swamp forests occupy the entire upper coastal delta. Historically the most important timber species of the inner delta was the Abura (Fleroya ledermannii), a Vulnerable swamp-loving West African tree, which has been reduced below populations viable for timber harvesting in the Niger Delta due to recent over-harvesting of this species as well as general habitat destruction of the delta due to the expanding human population here. Other plants prominent in the inner delta flood forest are: the Azobe tree (Lophira alata), the Okhuen tree (Ricinodendron heudelotii ), the Bitter Bark Tree (Sacoglottis gabonensis), the Rough-barked Flat-top Tree (Albizia adianthifolia), and Pycnanthus angolensis. Also present in its native range is the African Oil Palm (Elaeis guineensis)

There are a number of notable mammals present in the inner coastal delta, including the Near Threatened Olive Colobus (Procolobus verus) that is restricted to coastal forests of West Africa and is found here in the inner coastal Niger Delta. Also found here is the restricted distribution Mona Monkey (Cercopithecus mona), a primate often associated with rivers. Also occurring here is the limited range Black Duiker (Cephalophus niger), a near-endemic to the Niger River Basin. In addition, the Endangered Chimpanzee (Pan troglodytes) is found in the Niger Delta. The near-endemic White-cheeked Guenon (Cercopithecus erythrogaster, VU) is found in the inner delta. The Critically Endangered Niger Delta Red Colubus (Procolobus pennantii ssp. epieni), which primate is endemic to the Niger Delta is also found in the inner delta. 

Some of the reptiles found in the upper coastal Niger Delta are the African Banded Snake (Chamaelycus fasciatus); the West African Dwarf Crocodile (Osteolaemus tetraspis, VU); the African Slender-snouted Crocodile (Mecistops cataphractus); the Benin Agama (Agama gracilimembris); the Owen's Chameleon (Chamaeleo oweni); the limited range Marsh Snake (Natriciteres fuliginoides); the rather widely distributed Black-line Green Snake (Hapsidophrys lineatus); Cross's Beaked Snake (Rhinotyphlops crossii), an endemic to the Niger Basin as a whole; Morquard's File Snake (Mehelya guirali); the Dull Purple-glossed Snake (Amblyodipsas unicolor); the Rhinoceros Viper (Bitis nasicornis). In addition several of the reptiles found in the outer delta are found within this inner delta area.

Five threatened marine turtle species are found in the mangroves of the lower coastal delta: Leatherback Sea Turtle (Dermochelys coriacea, EN), Loggerhead Sea Turtle (Caretta caretta, EN), Olive Ridley Turtle (Lepidochelys olivacea, EN), Hawksbill Sea Turtle (Eretmochelys imbricata, CR), and Green Turtle (Chelonia mydas, EN).

Other reptiles found in the outer NIger Delta are the Nile Crocodile (Crocodylus niloticus), African Softshell Turtle (Trionyx triunguis), African Rock Python (Python sebae), Boomslang Snake (Dispholidus typus), Cabinda Lidless Skink (Panaspis cabindae), Neon Blue Tailed Tree Lizard (Holaspis guentheri), Fischer's Dwarf Gecko (Lygodactylus fischeri), Richardson's Leaf-Toed Gecko (Hemidactylus richardsonii), Spotted Night Adder (Causus maculatus), Tholloni's African Water Snake (Grayia tholloni), Smith's African Water Snake (Grayia smythii), Small-eyed File Snake (Mehelya stenophthalmus), Western Forest File Snake (Mehelya poensis), Western Crowned Snake (Meizodon coronatus), Western Green Snake (Philothamnus irregularis), Variable Green Snake (Philothamnus heterodermus), Slender Burrowing Asp (Atractaspis aterrima), Forest Cobra (Naja melanoleuca), Rough-scaled Bush Viper (Atheris squamigera), and Nile Monitor (Varanus niloticus).

There are a limited number of amphibians in the inner coastal delta including the Marble-legged Frog (Hylarana galamensis). At the extreme eastern edge of the upper delta is a part of the lower Niger and Cross River watersheds that drains the Cross-Sanaka Bioko coastal forests, where the near endemic anuran Cameroon Slippery Frog (Conraua robusta) occurs.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Olive colobus monkeys are arboreal and are restricted to rainforest habitat. They prefer the dense understory of the forest, often near water. Procolobus verus sometimes travels into the middle canopy to sleep, but never ventures to the upper stratum.

(Burton and Pearson, 1988; Flannery, 2000; Nowak, 1997)

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits forest, including rainforest, dry semi-deciduous forest, palm forest, forest margins, swamps forest, and abandoned cultivated areas (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Procolobus verus forage in understory and middle canopy of the forest, feeding mainly on young leaves. These monkeys are highly selective feeder, but seasonally they will also eat seeds, flowers, and petioles. When young foliage is available, they ignore mature leaves. Procolobus verus has a sacculated stomach to assist in the breakdown of cellulose in its primarily folivorous diet.

(Flannery, 2000; Oates, 1988)

Plant Foods: leaves; seeds, grains, and nuts; flowers

Primary Diet: herbivore (Folivore )

  • Oates, J. 1988. The diet of the olive colobus monkey, *Procolobus verus*, in Sierra Leone. International Journal of Primatology, 9/5: 457-478.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The ecosystem role of these animals is not well understood. We may assume that to the extent that other animals prey upon these monkeys, they serve as a control on predator populations. They may also help to disperse seeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Procolobus verus is the most accomplished leaper in the Tai Forest, where it commonly lives. This capability of P. verus allows it to avoid predators that share this habitat. It also frequently groups with Diana monkeys to avoid predation. Procolobus verus is hunted by humans for its meat and skin.

(Noe and Bshary)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Procolobus verus is prey of:
Homo sapiens
Panthera pardus
Stephanoaetus coronatus
Pan troglodytes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication in these monkeys is not well described. However, we may assume that they are like other primates, and use various means of communication. Included in these are visual signals, such as facial expressions and body postures, vocalizations, and tactile communication, including grooming, playing, and aggression.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of these animals has not been reported, but other leaf eating monkeys rarely live in excess of 30 years in captivity. It is likely that P. verus is similar.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
29 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

These colobines are reported to be polygynous.

Mating System: polygynous

Olive colobus monkeys have a gestation period of 5 to 6 months, with no specific breeding season. Females reproduce about every two years and usually bear only one young at a time. Females reach sexual maturity around 3 to 4 years old, males around 5 to 6 years old. Female P. verus have perineal organs that swell during estrus.

Breeding interval: Females can produce young once every 2 years.

Breeding season: Breeding in this species occurs throughout the year.

Average number of offspring: 1.

Range gestation period: 5 to 6 months.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 5 to 6 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Female P. verus carry their young around in their mouths for a few weeks after birth, a behavior not observed in Colobus species. As the young matures, it is carried on the abdomen of the mother. Mothers provide milk, grooming and protection for the young. The role of males in care of infants has not been reported.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Procolobus verus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGCTCATTAACCGCTGGTTATTCTCTACAAATCATAAAGATATTGGAACTTTATATTTATTATTCGGAGCATGAGCTGGAATTATAGGCATAGCTATAAGTCTTCTAATCCGAGCCGAACTAGGCCAACCCGGTAACCTATTAGGCAACGACCATATTTATAATGTTATTGTTACTGCCCATGCATTCGTTATAATTTTCTTTATAGTTATACCCATCATGATTGGAGGCTTTGGAAACTGACTAGTGCCTCTAATAATTGGCGCTCCTGACATAGCATTTCCCCGCCTAAATAATATAAGCTTTTGACTTCTCCCGCCATCCTTCCTGCTTCTTCTTGCATCGGCTATAGTGGAAGCTGGCGCTGGAACCGGATGAACGGTCTATCCCCCTCTAGCAGGAAACTTGTCTCACCCAGGGGCCTCTGTAGATCTAACTATCTTCTCACTCCATCTAGCAGGTATCTCCTCTATCTTAGGGGCCATTAATTTCATCACAACTATTATTAACATAAAACCCCCCGCAATCTCCCAGTACCAAACACCTTTATTCGTTTGATCAGTTCTAATTACAGCAGTCCTATTACTTCTATCCCTTCCCGTACTAGCTGCCGGCATCACAATACTATTAACAGACCGTAATCTCAATACTACCTTCTTCGACCCTGCCGGTGGAGGAGATCCTATTTTATATCAACACTTATTCTGATTTTTTGGTCACCCCGAAGTCTATATTCTTATTCTACCTGGCTTCGGGATAATCTCCCACATTGTGACATATTACTCTGGAAAAAAAGAACCATTTGGATATATAGGTATGGTCTGAGCTATAATGTCTATCGGTTTCTTAGGCTTTATTGTATGAGCCCACCATATATTTACAGTTGGCATAGACGTAGATACACGAGCCTATTTCACCTCCGCTACTATAATTATTGCTATCCCAACTGGCGTCAAAGTCTTCAGCTGGCTTGCTACACTTCATGGAGGTAACATCAAATGATCCCCTGCAATACTCTGAGCCTTAGGCTTCATTTTCCTCTTTACCGTAGGAGGCCTAACTGGTATTGTATTAGCAAATTCATCCCTAGATATCGTATTACATGATACATACTATGTCGTAGCCCATTTCCACTATGTCTTATCAATAGGAGCGGTCTTCGCCATTATAGGAGGCTTTATCCATTGATTTCCTTTATTTTCAGGTTATACCCTAGACCAAGTCTGCGCCAAAGCCCACTTCGTAATTATATTTGTAGGTGTAAATTTAACTTTCTTCCCGCAGCACTTTCTTGGCTTATCTGGAATACCCCGACGCTACTCTGACTACCCTGATGCCTACACCACCTGAAATATTGTATCCTCTATAGGCTCCTTTATTTCCCTAGTAGCAATACTATTAATAGTCTATATAATCTGAGAGGCCTTCGCCTCAAAGCGTAAAGTCCTATTAATTGAACAGCCTACATCTAATCTGGAGTGACTACATGGCTCCCCTCCACCCTATCACACATTTGATGAGCCAGTCTTCATCAAAATCAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Procolobus verus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Oates, J.F., Gippoliti, S. & Groves, C.P.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Near Threatened as this species is believed to have undergone a decline exceeding 20% over the past 27 years or so, mainly as a result of hunting and extensive habitat loss, especially in the eastern parts of their range. Their cryptic nature and ability to survive in small forest fragments and to adapt to some anthropogenic disturbance has no doubt enabled them to persist and remain common in parts of their range. Almost qualifies as threatened under criterion A2cd.

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Rare
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although this species is not of special conservation concern, all primates are listed as CITES appendix II because they are vulnerable to habitat loss.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although quite secretive, they remain common in many parts of its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is probably declining due to loss of its forest habitats and hunting, especially in the far eastern part of its range, towards Nigeria.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Like many forest-dwelling primates, habitat loss and hunting pose the greatest threat to the existence of the olive colobus (1) (2), and populations may be declining as a result (2). However, a study revealed that the olive colobus may actually be very tolerant of hunting, but is greatly impacted by agriculture invading their natural habitat (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Olive Colobus is listed as a Class A species under the African Convention, and under Appendix II of CITES. It occurs in a number of protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The olive colobus occurs in a number of protected areas (5), such as the Taï National Park in Cote d'Ivoire (11), and is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that any international trade in this species should be carefully monitored (3). Otherwise, there are no known conservation measures in place specifically aimed at the rarely seen olive colobus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of P. verus on humans. However, as primates, they may carry some of the same disease organisms which affect people.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Procoloby verus is hunted by humans for food.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Olive colobus

The olive colobus monkey (Procolobus verus), also known as the Green colobus or Van Beneden's colobus, is a species of primate in the Cercopithecidae family. Its English name refers to its dull olive upperparts.[3] It is the smallest example of all colobine monkeys and is rarely observed in its natural habitat because of its cryptic coloration and secretive nature.[4] It is found in the rain forests of West Africa, ranging from southern Sierra Leone to Nigeria.[5] The olive colobus is classified as near threatened by the IUCN Red List, the cause of its decline attributed to habitat loss and hunting.[5] Though much of the land within the range of the olive colobus has been affected by human activities, it retains its ability to thrive in small degraded forest fragments.[5]

Description[edit]

Procolobus verus is a small-bodied mammal with an average body weight of 4.6 kilograms for males and 4.1 kilograms for females.[4] The olive colobus are greenish-brown in color with the hairs transitioning from greenish-yellow at the root, and becoming darker towards the tip.[6] The under side of the olive colobus is lighter in color and the hairs found on the face are stiff and dark.[6] Their coloration allows them to stay camouflaged within the trees reducing the risk of predation. These monkeys have a unique feature in that their thumb is severely reduced on their forefeet, while the hindfeet retain five digits.[6] The feet of the olive colobus are also abnormally large compared to other African colobine species.[7]

Diet[edit]

The natural habitat of the olive colobus includes second growth within tall forests, palm forests and swamps, where they feed in the lower and middle vegetation strata.[5] The olive colobus is mainly folivorous, although it may consume fruits and seeds when available.[8] The diet consists primarily of young leaves, and they tend to avoid mature leaf parts altogether. This is related to the fact that it is a forestomach fermenter with a small body size, which requires it to obtain a very high quality diet.[8] The fact that olive colobus monkeys utilize this type of fermentation also relates to their lack of fruit consumption because things such as fruits that contain high levels of acid can lower the pH of the stomach causing negative and sometimes lethal effects on microorganisms living within the stomach.[8]

Behavior[edit]

The olive colobus monkey is a very cryptic and shy animal, which can make the observation and understanding of its behavior difficult. What is known about interactions between olive colobus monkeys and other related species shows that their social structure is very complex. Olive colobus monkeys are found in small groups containing multiple breeding males, several females, and their infants.[9] Though found in groups of only a few individuals, olive colobus monkeys are almost always seen in association with other Cercopithecus monkeys, particularly the Diana monkey.[9] There have been many suggestions as to how this relationship benefits the olive colobus, such as reducing the risk of predation.[9] A piece of evidence that gives support to this idea is the willingness of the olive colobus to travel to higher altitudes in the tree tops to feed when other species are nearby.[5]

In addition to serving as a means of predator avoidance, the close association with Diana monkeys is a mechanism used by male olive colobus monkeys to obtain new female mates. The olive colobus mating system is unique in that unlike many species living in small groups, there is no evidence of male monopolization over females. It has been proposed that females use aspects of their reproductive biology(long receptive periods, promiscuous mating, and mating overlap among females) along with mating behaviors to limit the monopolization of males in a group. Benefits to the avoidance of male monopolization include direct or indirect female mate choice, decreasing the risk of infanticide, and increased paternal care for offspring.[9]

Conservation[edit]

The olive colobus monkey is very susceptible to habitat loss due to increased enroachment of hunters and farmers on both protected and unprotected lands. In order to ensure that this threatened species is protected, the olive colobus has been listed under Appendix II of CITES (the Convention on International Trade in Endangered Species of Wild Fauna and Flora) and as a Class A species under the African Convention on the Conservation of Nature and Natural Resources, which monitor the international trade of species and their status in the environment.[5] The olive colobus is also covered in many protected areas including Taï National Park on the Ivory Coast of West Africa, which was declared a Forest and Wildlife Refuge in 1926 and accepted as a biosphere reserve in 1982.[10] The park has a total area of 330,000 hectares, plus a 20,000-hectare buffer zone, where new plantations and settlement are prohibited.[11]

Though efforts have been established in order to protect the olive colobus monkey and its habitat, illegal farming and hunting are still a fundamental threat to this species' survival. To ensure that the olive colobus will thrive in the future, stricter enforcement of laws and regulations should be implemented, as well as the development of educational and public awareness plans. The olive colobus will also benefit from further study and observation.[11]

References[edit]

  1. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 169, 172–173. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Oates, J. F., Gippoliti, S. & Groves, C. P. (2008). Procolobus verus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 4 January 2009.
  3. ^ Kingdon, J. (1997). The Kingdon Guide to African Mammals. Academic Press Limited, London. ISBN 0-12-408355-2.
  4. ^ a b Oates, J.F.(1988). "The Diet of the Olive Colobus Monkey, Procolobus verus, in Sierra Leone." International Journal of Primatology,9(5),457-478.
  5. ^ a b c d e f Oates, J.F.,Gippoliti, S. & Groves, C.P. 2008. Procolobus verus. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. <www.iucnredlist.org>. Downloaded on 8 December 2011.
  6. ^ a b c Osman Hill, W.C. (1952). "The External and Visceral Anatomy of the Olive Colobus Monkey (Procolobus verus)." Proceedings of the Zoological Society of London, 122 (1), 127-186.
  7. ^ McGraw, W.S., & Zuberbühler, K. The Monkeys of the Taï Forest: an Inroduction. McGraw, W.S., Zuberbühler, K., & Nöe, R. (Eds.) (2007). Monkeys of the Taï Forest: an African Primate Community. Cambridge University Press.
  8. ^ a b c Davies, A.G., Oates, J. F., & Dasilva, G.L. (1999). "Patterns of Frugivory in Three West African Colobine Monkeys." International Journal of Primatology, 20 (3), 327-357.
  9. ^ a b c d Korstjens, A.H. & Nöe, R. (2004)."Mating System of an Exceptional Primate, the Olive Colobus (Procolobus verus)."American Journal of Primatology, 62: 261-273.
  10. ^ "Taï National Park." UNESCO World Heritage Centre. Retrieved 2011-11-7
  11. ^ a b McGinley, Mark. "Taï National Park, Côte d'Ivoire." The Encyclopedia of Earth. 14 October 2008. Retrieved 2011-11-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!