Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
den Hartog, 1980 YES MINERAL ARAGONITE
Wallace, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Acropora cervicornis occurs only in the western Atlantic (one of three Acropora species found in the Atlantic). However, some of the ~120 Acropora species in the Pacific may also sometimes be referred to as "staghorn coral", leaving the incorrect impression that A. cervicornis occurs in the Pacific as well (S.D. Cairns, in litt. December 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 2 people

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, Jamaica, Cuba, Belize, Mexico, Puerto Rico, Lesser Antilles, Panama and Curacao. Smith (1971): Florida, Bahamas. Colin (1978): throughout the Caribbean. Jones (1977), Davis (1977), Dustan (1977, 1985), Dustan and Halas (1987), Glynn et al. (1989), Jaap (1984), Jaap et al. (1989), Wheaton and Jaap (1988), Burns (1985), White and Porter (1985), Goldberg (1973a), Marszalek (1981): southern Florida. Farrell et al. (1983), Tunnell (1988): southwestern Gulf of Mexico. Lang et al. (1988): Bahamas. K¿hlmann (1974), Zlatarski and Estalella (1982): Cuba. Woodley et al. (1981), Tunnicliffe (1983), Hughes (1985), Hughes and Jackson (1985), Knowlton et al. (1981), Goreau and Wells (1967), Goreau (1959), Liddell and Ohlhorst (1981, 1987): Jamaica. Roberts (1971): Cayman Islands. Jordan et al. (1981), Fenner (1988): Yucatan, Mexico. Almy and Carrion-Torres (1963), Pressick (1970), Loya (1976), Rogers (1979): Puerto Rico. Gladfelter et al. (1978), Rogers et al. (1983), Edmunds et al. (1990): USVI. Dunne and Brown (1979): Anegada. Scatterday (1974), Bak (1981): Cura¿ao and Bonaire. Highsmith (1982): Panama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, southern Gulf of Mexico, Florida, and the Bahamas and has been documented as far north as Palm Beach (26 deg 3'N) along Florida’s east coast (Goldberg 1973).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Species of the genus -Acropora- are favorable to warm water marine environments. In particular, -Acropora cervicornis- is one of the primary reef building corals in the Caribbean (Birkeland 1997). These species are also located in the Great Barrier Reef of Australia (McGregor 1974).

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (FL, PR, VI, Navassa); and wider Caribbean- Belize, Colombia, Costa Rica, Guatemala, Honduras, Mexico, Nicaragua, Panama, Venezuela, and all the islands of the West Indies.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These corals commonly have tentacles in multiples of three, which is characteristic of all corals belonging to the subclass Zoantharia, also known as Hexacorallia (Encarta 1997). At night, the tiny fingerlike tentacles of the corals emerge. They pump themselves up with water and pop out like tiny stars all over a coral reef (Sargent 1991). The staghorn coral, -A. cervicornis-, grows into "antler-like branches" so the polyps are raised above the sand (McGregor 1974). Staghorn corals have nematocysts, which are stinging cells that are located on their tentacles. These stinging cells are necessary for a coral to obtain food (Sisson 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tentacles occur in multiples of 6, as is true for all stony corals (S.D. Cairns, in litt. December 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Also distributed in Australia in Kalk (1958). Tropical Indo-Pacific in Kalk (1958).
  • Sheppard, C.R.C. (1987). Coral species of the Indian Ocean and adjacent seas: a synonymised compilation and some regional distribution patterns. Atoll Research Bulletin Nr 307
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Occupies depth range from 0-50 m, but typically occurs between 15-30 m on fore-reef communities on bank reefs and fringing reefs (Goreau and Wells, 1967; Adey, 1977; Tunnicliffe, 1983).

Goreau and Wells (1967): 0 to 50 m (15-30 m optimum depth). Goldberg (1973a): outer reef platform (16-20 m). Gilmore and Hall (1976): patch reefs. Adey (1977): major mid-depth (10-25 m) reef builder. Cairns (1982): back reef to outer ridge. Davis (1982): octocoral-dominated hardgrounds. Tunnell (1983): occupies most extensive depth range (0-30 m) in genus. Jaap (1984): bank reefs and transitional reefs. Wheaton and Jaap (1988): spur and groove reefs, back reef.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found in shallow tropical reef ecosystems, favouring upper to mid-reef slopes and lagoons in areas with moderate to low wave exposure. It is usually recorded from 1 m to around 25 m (Aronson and Precht 2001a,b), with occasional records to 60 m (Goreau and Goreau 1973).

Recruitment by sexual reproduction is limited.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Acropora cervicornis like to live in warm, marine water close to the surface. The tropical western regions of the oceans are where there is most of the coral diversity of coral reef organisms (Birkeland 1997). The polyps that form the coral need tropical waters where the temperatures are higher than 20 degrees centigrade and there is adequate light. They also require a hard surface for which the coral polyps can settle. Staghorn corals, as well as all other corals, need very oxygenated water containing adequate supplies of small planktonic animals. Corals also need clear water, because apart from reducing the light, and heavy rain of sediment would smother them (McGregor 1974)

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1029 specimens in 1 taxon.
Water temperature and chemistry ranges based on 534 samples.

Environmental ranges
  Depth range (m): 0.2 - 71.5
  Temperature range (°C): 26.383 - 28.034
  Nitrate (umol/L): 0.115 - 3.153
  Salinity (PPS): 35.207 - 36.533
  Oxygen (ml/l): 4.285 - 4.736
  Phosphate (umol/l): 0.020 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.2 - 71.5

Temperature range (°C): 26.383 - 28.034

Nitrate (umol/L): 0.115 - 3.153

Salinity (PPS): 35.207 - 36.533

Oxygen (ml/l): 4.285 - 4.736

Phosphate (umol/l): 0.020 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Sedentary

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Staghorn corals use their nematocysts which are located on their tentacles for eating and gaining food. Surprisingly some Acropora species have actually been seen capturing live fish (Sisson 1973). Staghorn corals also eat planktonic animals which float by in the water (McGregor 1974).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Colonizes numerous classes of marine hard-bottom communities, including low-relief hard-bottom areas, patch reefs, spur and groove reefs, fringing reefs, transitional reefs and deeper intermediate reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Dustan (1977), Tunnell (1983): preyed upon by Hermodice caruncullata (fire worm) and Coralliophila abbreviata. Shinn (1976): linear growth rate of 80-264 mm/yr. Gladfelter et al. (1978): linear growth rate estimated at 71 mm/yr. Peters (1984): inflicted with white band disease. Ghiold and Smith (1990), Williams and Bunkley-Williams (1990): susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Szmant (1986): sexual mode is hermaphroditic protogynous; gametogenesis for females is from September to April and for males is from June to July. Spawning occurs in late August with external larval development. Bak and Engel (1979), Rylaarsdam (1983), Rogers et al. (1984): low reported recruitment rates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As in all corals, the Staghorn Coral reproduces both sexually and asexually. The very first stage of reproduction is a sexually-caused stage of reef-building. This occurs when existing polyps expel millions of spermatoza into the water. Some of these gametes are drawn into other polyps that are nearby; the eggs that are produced there are then fertilized and larva develop and float away to produce new polyps. The larva, called planula, are extremely small and bulb-shaped. They are constantly changing shape as they swim/drift (Sisson 1973). They have a mouth at the upper end, which is the wider end with cilia like hairs all over them that are constantly beating and help support them to the surface. The planula that survive predators while floating through the water settle on a suitable hard surface in warm water and attach themselves by spreading out into a disk (Sisson 1973). Once they land here, they begin to secrete a white starlike outer skeleton which permanently cements it to a spot and develop tentacles and grow into mature polyps. Once the first skeletons are built, the founders, or the sexually produced polyps, multiply by asexual methods. Acropora grow branches, which are also known as buds, that become the daughter polyps, which then bud more daughters (McGregor 1974).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Structure protects against compression loading: staghorn coral
 

The structure of staghorn coral is just one example of a natural branched system that protects against compression loading using scaled struts joined in a common lattice.

   
  "In nature we notice trees, branching corals, and other fairly stiff items. In these systems, all of the struts join in a common lattice, and no motion is permissible at joints--they're simple, statically determined systems. If our systems branch, they're usually equipped with lots of triangular elements, although some crude cases (frame houses) use an array of mechanisms braced against any possible deformations by a structural skin of plywood or something similar. In nature, more often than not, the branches of a system diverge without rejoining, although struts are sometimes joined into trusses--the arms of some sand dollar larvae and some bones in the wings of large birds have already been mentioned." (Vogel 2003:437)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Branches protect by breaking: Caribbean stony coral
 

Branches of Caribbean stony coral protect the core colony by programmed breakage.

   
  "The Caribbean stony coral Acropora cervicornis forms long, slim branches (a stress increasing shape) supported by brittle skeletal material. We can predict that these corals would break in rapid water flow, yet we find that they thrive on wave-swept forereefs. A. cervicornis do often break, but the broken-off pieces survive and grow. Such 'programmed breakage' and growth appears to be the main mechanism of asexual reproduction and dispersal of A. cervicornis colonies…Furthermore, when bits of an organism or colony break off, the flow forces on the whole structure can be reduced, hence partial breakage can prevent total destruction." (Koehl 1984:67)
  Learn more about this functional adaptation.
  • Koehl, M. A. R. 1984. How do benthic organisms withstand moving water. Amer. Zoologist. 24: 57-70.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acropora cervicornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACGTTATATTTAGTCTTTGGGATTGGGGCAGGCATGATTGGCACGGCCTTCAGTATGTTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGCTAGGAGAC---GATCATCTTTATAATGTAATTGTTACGGCACATGCTTTTATTATGATTTTTTTTTTGGTTATGCCAGTGATGATAGGGGGGTTTGGAAATTGGTTGGTTCCACTATATATTGGTGCTCCCGACATGGCCTTCCCCCGGCTTAATAATATTAGTTTTTGGTTGTTGCCTCCTGCTCTAATATTGTTATTAGGCTCCGCTTTTGTTGAACAAGGAGTTGGTACCGGGTGGACGGTGTATCCTCCTCTATCGAGCATCCAGGCTCACTCTGGGGGGGCGGTGGACATGGCTATTTTTAGCCTTCACTTAGCTGGGGTGTCTTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTGAATATGCGGGCCCCTGGGATGACATTAAATAAAATGCCATTGTTTGTGTGGTCTATCTTGATTACTGCTTTTTTATTATTACTACCTTTGCCAGTACTAGCGGGGGCGATAACCATGCTTTTAACGGATAGAAATTTTAATACCACTTTTTTTGATCCCGCCGGAGGGGGAGACCCAATTTTATTTCAGCATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acropora cervicornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Although this species appears to have a wide distribution, declines of 80-98% have been documented since the 1980's and it is listed as critically endangered by the IUCN (Aronson et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2ace

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
This species is listed as Critically Endangered as there has been a population reduction exceeding 80% over the past 30 years due, in particular to the effects of disease, as well as other climate change and human-related factors. This species is particularly susceptible to bleaching. Although the current population is persisting at a very low abundance and the current population trend appears to be stable, there are places where populations continue to decrease and others where there seems to be moderate or localized recovery. Whether mortality continues to exceed growth and recruitment or not, this species requires immediate investigation and monitoring on a regional scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/08/2006
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: Entire
Listing status: T

For most current information and documents related to the conservation status and management of Acropora cervicornis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The coral reefs in the eastern tropical Pacific have been most severly degraded by climatic events. Especially after the El Nino of 1982-1983. Many of these reefs have continued to deteriorate since then because coral recruitment has been sparse and sea urchins continue to erode away the framework of the coral. Coral bleaching (loss of zooxanthellae and/or pigment) has been increasingly wide-spread and frequent. In a survey of more than 2,000 sites in the British Virign Islands, it was found that over 95% of Acropora were dead in 1993.

US Federal List: threatened

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

  • Birkeland, .. 1997. Life and Death of Coral Reefs. New York: Chapman and Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Declining populations in south Florida and the Caribbean due to thermal events, anchor damage, and diseases of unknown etiology (Dustan, 1977; Tunnicliffe, 1983; Peters, 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There has been an 80-98% loss of individuals in parts of the Caribbean region since the 1980's. There have been some signs of recovery. A second report has validated declines on the order of 97% in the Florida Keys, Jamaica, Dry Tortugas, Belize and St Croix (Acropora BRT 2005) and Puerto Rico (Weil et al. 2003).

There are populations present off the coast of Broward County (Florida), Mona Island (Puerto Rico), places in the southern Caribbean, and Dairy Bull Reef in northern Jamaica (Idjadi et al. 2006).

Overall, decline of destroyed and critical reefs in the Caribbean region has been 38% (according to Wilkinson 2004) however there have been much higher population reductions for this species as it is particularly susceptible to disease and bleaching.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Considered extremely threatened due to high sensitivity to sedimentation, eutrophication, disease, bleaching, salinity, and mechanical damage (Davis, 1977; Curtis, 1985).
Davis (1977): extensive anchor damage in Dry Tortugas, Florida. Curtis (1985): damage from vessel groundings in southern Florida

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
The major threat to this species has been disease, specifically white-band disease which is believed to be the primary cause for the region-wide acroporid decline during the 1980s (Aronson and Precht, 2001a,b) and is still ongoing (Williams and Miller, 2005). Other major threats include thermal-induced bleaching, storms, and predation by Stegastes planifrons (Three-spot Damselfish) (Precht et al. 2002,Acropora BRT 2005).

Localized declines are associated with: loss of habitat at the recruitment stage due to algal overgrowth and sedimentation; predation by snails; mortality by endolithic sponges; ship groundings, anchor damage, trampling, and marine debris.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Data needed on recruitment patterns and susceptibility to eutrophication and sedimentation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected populations in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys should be installed proximate to populations in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Listed on CITES Appendix II and Threatened on the US Endangered Species Act. In the US, this species is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, and Buck Island Reef National Monument. Also present in Hol Chan Marine Reserve (Belize) and Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. Localized efforts to propagate and reintroduce the species have occurred in Florida, Puerto Rico, Domincan Republic, Jamaica and Honduras (A. Bruckner pers. comm.). In response to ship grounding and hurricanes, there have been efforts in some areas to salvage damaged corals and reattach them in acroporid habitats.

More information is needed to assist the recovery of acroporids including survival and fecundity by age, sexual and asexual recruitment, population information, juvenile population dynamics, importance of habitat variables to recruitment and survivorship, and location of populations showing signs of recovery (Bruckner, 2002). Further research is needed into disease etiology, and effectiveness of current restoration methods.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There really are not any negative effects that corals cause to humans. Sometimes they can damage or wreck a boat, but usually they are pretty harmless to humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Acropora cervicornis house many creatures, some of which may be useful to the medical research field. Some of the species that live in the corals have already yeilded compounds active against inflammations, asthma, leukemia, tumors, heart disease, fungal and bacteria infections, and even viruses including HIV (Chadwick 1999). Staghorn corals are also of vital importance to the stabilization of coastlines, as fish habitats, and for the protection of our biodiversity (Nemoto 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Populations on nearshore reef communities need to be monitored for viability as related to water quality.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Staghorn coral

The staghorn coral (Acropora cervicornis) is a branching, stony coral with cylindrical branches ranging from a few centimetres to over two metres in length and height. It occurs in back reef and fore reef environments from 0 to 30 m (0 to 98 ft) depth. The upper limit is defined by wave forces, and the lower limit is controlled by suspended sediments and light availability. Fore reef zones at intermediate depths 5–25 m (16–82 ft) were formerly dominated by extensive single-species stands of staghorn coral until the mid-1980s. This coral exhibits the fastest growth of all known western Atlantic fringe corals, with branches increasing in length by 10–20 cm (3.9–7.9 in) per year. This has been one of the three most important Caribbean corals in terms of its contribution to reef growth and fishery habitat.

Distribution[edit]

Staghorn coral is found throughout the Florida Keys, the Bahamas, the Caribbean islands and the Great Barrier Reef. This coral occurs in the western Gulf of Mexico, but is absent from U.S. waters in the Gulf of Mexico, as well as Bermuda and the west coast of South America. The northern limit is on the east coast of Florida, near Boca Raton. In the South-East Asia, it grows rapidly and abundantly in the reefs of the coasts of Sabah, Malaysia.

Threats and concerns[edit]

'Acropora cervicornis, Bonaire, 2007, notice the "stems" reacting to a disease.

The dominant mode of reproduction for staghorn corals is asexual, with new colonies forming when branches break off a colony and reattach to the substrate. This life history trait allows rapid population recovery from physical disturbances such as storms. However, it makes recovery from disease or bleaching episodes (where entire colonies or even entire stands are killed) very difficult.

Sexual reproduction is via broadcast spawning of gametes into the water column once each year in August or September. Individual colonies are both male and female (simultaneous hermaphrodites) and will release millions of gametes. The coral larvae (planula) live in the plankton for several days until finding a suitable area to settle; unfortunately, very few larvae survive to settle and metamorphose into new colonies. The preponderance of asexual reproduction in this species raises the possibility that genetic diversity in the remnant populations may be very low. These uncertainties as to recruitment/recovery potential and genetic status are the bases for increased demographic concerns for this species.

Since 1980, populations have collapsed throughout their range from disease outbreaks (primarily White band disease), with losses compounded locally by hurricanes, increased predation, bleaching, and other factors. This species is also particularly susceptible to damage from sedimentation and sensitive to temperature and salinity variation. Populations have declined by up to 98% throughout the range, and localized extirpations have occurred.

ESA listing history[edit]

On March 4, 2004, the Center for Biological Diversity petitioned NMFS to list elkhorn (Acropora palmata), staghorn (A. cervicornis), and fused-staghorn (A. prolifera) coral under the ESA. On June 23, 2004, NOAA Fisheries found that listing these species may be warranted and initiated a formal review of their biological status. NMFS convened the Atlantic Acropora Biological Review Team (BRT) to summarize the best available scientific and commercial data available for these species in the status review report.

The BRT completed the status review March 3, 2005. On March 18, 2005, NMFS determined elkhorn and staghorn corals warrant listing as "threatened" species under the ESA. However, NMFS also concluded listing fused-staghorn coral is not warranted, as it is a hybrid and does not constitute a species as defined under the ESA. On May 9, 2005, NMFS proposed adding elkhorn coral to the endangered species list and the listing was finalized on May 9, 2006.

Gallery[edit]

References[edit]

  1. ^ Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil (2008). "Acropora cervicornis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 21 May 2014. 
  2. ^ WoRMS (2010). "Acropora cervicornis (Lamarck, 1816)". World Register of Marine Species. Retrieved 2011-12-09. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!