Overview

Distribution

circum-(sub)tropical
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

coastal to shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 2.5 - 130
  Temperature range (°C): 25.772 - 27.718
  Nitrate (umol/L): 0.062 - 0.430
  Salinity (PPS): 35.249 - 35.901
  Oxygen (ml/l): 4.313 - 4.821
  Phosphate (umol/l): 0.120 - 0.153
  Silicate (umol/l): 0.965 - 1.019

Graphical representation

Depth range (m): 2.5 - 130

Temperature range (°C): 25.772 - 27.718

Nitrate (umol/L): 0.062 - 0.430

Salinity (PPS): 35.249 - 35.901

Oxygen (ml/l): 4.313 - 4.821

Phosphate (umol/l): 0.120 - 0.153

Silicate (umol/l): 0.965 - 1.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ammothella appendiculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATATATTTAATTTTTGGAGCTTGAGCTGGAATAGTAGGAACCTCTTTGAGGATGTTAATTCGAACTGAATTAGGTACACCATCCTCTGTAATTGGTGAT---GATCAAATTTATAATGTTGTAGTTACTTCACATGCTTTTGTAATAATTTTTTTTATAATTATACCTACTATAATTGGGGGATTTGGAAATTGATTAGTCCCTATTATAATTAATGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTACTCCCTCCATCATTATTATTATTATTAACTTCATCTTTAGTTGAAATAGGAGCCGGTACTGGATGAACAGTTTATCCTCCTCTTTCTTCTAATATATCTCATTCAGGTTCTTCTGTTGATTTAGTAATTTTCTCTTTACATTTAGCTGGTATCTCTTCTATCTTGGGAGCTATTAATTTTATTAGAACTATTATAAACATACGTACCTCAGGTATAGAATTAATTCAAATACCTCTATTTGTATGAAGTGTTTTAATTACAGCTGTGTTATTATTACTTTCTTTACCTGTTTTAGCAGGGGCTATTACAATGTTGTTAACTGATCGTAATTTTAATACTTCATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCGGAAGTTTATATTTTAATTTTACCTGGGTTTGGTATAATTTCTCATATTTTGGTAACTGAAAGAGGTAAAAAAGAGATTTTTGGTACTTTGGGTATAATTTATGCAATATTATCAATTGGATTTTTAGGATTTATTGTTTGAGCACATCATATGTTTACTGTTGGAATAGATGTAGATACTCGAGCATATTTTACAGCTGCTACCATAATTATTGCAATTCCAACAGGAATTAAAATTTTTAGATGGATAGCAACTATTCATGGTTCT---CAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ammothella appendiculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!