Overview
Brief Summary
Biology
azooxanthellate
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Comprehensive Description
Biology: Skeleton
More info
| Author | Skeleton? | Mineral or Organic? | Mineral | Percent Magnesium |
|---|---|---|---|---|
| Cairns, 1991 | YES | MINERAL | ARAGONITE | |
| Cairns, 1994 | YES | MINERAL | ARAGONITE | |
| Cairns and Keller, 1993 | YES | MINERAL | ARAGONITE | |
| Cairns, 1998 | YES | MINERAL | ARAGONITE | |
| Song, 2000 | YES | MINERAL | ARAGONITE | |
| Cairns, Hoeksema, and van der Land, 1999 | YES | MINERAL | ARAGONITE |
Trusted
Distribution
Atlantic, Brazilian Exclusive Economic Zone, Caribbean Sea, Gulf of Mexico, Indo-Pacific, New Zealand Exclusive Economic Zone, West Africa
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
Nunes FLD, Norris RD, Knowlton N. (2011). Long Distance Dispersal and Connectivity in Amphi-Atlantic Corals at Regional and Basin Scales. PLoS ONE 6(7): e22298.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=162909
Trusted
Ecology
Habitat
Depth range based on 70 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.
Environmental ranges
Depth range (m): 0 - 84
Temperature range (°C): 22.214 - 28.472
Nitrate (umol/L): 0.009 - 6.523
Salinity (PPS): 33.101 - 36.212
Oxygen (ml/l): 4.215 - 5.017
Phosphate (umol/l): 0.027 - 0.824
Silicate (umol/l): 0.874 - 5.791
Graphical representation
Depth range (m): 0 - 84
Temperature range (°C): 22.214 - 28.472
Nitrate (umol/L): 0.009 - 6.523
Salinity (PPS): 33.101 - 36.212
Oxygen (ml/l): 4.215 - 5.017
Phosphate (umol/l): 0.027 - 0.824
Silicate (umol/l): 0.874 - 5.791
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 23 samples.
Environmental ranges
Depth range (m): 0 - 84
Temperature range (°C): 22.214 - 28.472
Nitrate (umol/L): 0.009 - 6.523
Salinity (PPS): 33.101 - 36.212
Oxygen (ml/l): 4.215 - 5.017
Phosphate (umol/l): 0.027 - 0.824
Silicate (umol/l): 0.874 - 5.791
Graphical representation
Depth range (m): 0 - 84
Temperature range (°C): 22.214 - 28.472
Nitrate (umol/L): 0.009 - 6.523
Salinity (PPS): 33.101 - 36.212
Oxygen (ml/l): 4.215 - 5.017
Phosphate (umol/l): 0.027 - 0.824
Silicate (umol/l): 0.874 - 5.791
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Tubastraea coccinea
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GCAGGTATGCTCGGCACGGCCTTCAGTATGCTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACGGCACACGCTTTGATTATGATTTTTTTTTTGGTTATGCCAGTGATGATAGGGGGGTTTGGGAATTGGTTGGTTCCATTATATATTGGAGCACCTGATATGGCTTTCCCACGGCTTAATAATATTAGTTTTTGGTTGTTGCCTCCTGCTTTAATATTATTATTAGGCTCCTCTTTCGTTGAACAAGGAGCTGGTACCGGGTGAACGATTTATCCTCCTTTAGCTGGCATTCAGGCCCATTCTGGCGGGGCGGTGGATATGGCTATTTTTAGTCTCCACTTAGCTGGGGCGTCCTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTTAATATGCGGGCTCCCGGGGTAACGTTGAATAGAATGCCCTTATTTGTGTGGTCTATCTTGATTACTGCTTTTTTATTATTATTGTCTTTGCCTGTATTAGCGGGGGCAATAACCATGCTTTTAACGGATAGAAACTTTAACACTACTTTCTTCGACCCTGCAGGGGGGGGGGATCCGATTTTATTTCAGCATTTG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Tubastraea coccinea
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

