Overview

Brief Summary

Biology

azooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, 1991 YES MINERAL ARAGONITE
Cairns, 1994 YES MINERAL ARAGONITE
Cairns and Keller, 1993 YES MINERAL ARAGONITE
Cairns, 1998 YES MINERAL ARAGONITE
Song, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 70 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 0 - 84
  Temperature range (°C): 22.214 - 28.472
  Nitrate (umol/L): 0.009 - 6.523
  Salinity (PPS): 33.101 - 36.212
  Oxygen (ml/l): 4.215 - 5.017
  Phosphate (umol/l): 0.027 - 0.824
  Silicate (umol/l): 0.874 - 5.791

Graphical representation

Depth range (m): 0 - 84

Temperature range (°C): 22.214 - 28.472

Nitrate (umol/L): 0.009 - 6.523

Salinity (PPS): 33.101 - 36.212

Oxygen (ml/l): 4.215 - 5.017

Phosphate (umol/l): 0.027 - 0.824

Silicate (umol/l): 0.874 - 5.791
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

0-110 m
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tubastraea coccinea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAGGTATGCTCGGCACGGCCTTCAGTATGCTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACGGCACACGCTTTGATTATGATTTTTTTTTTGGTTATGCCAGTGATGATAGGGGGGTTTGGGAATTGGTTGGTTCCATTATATATTGGAGCACCTGATATGGCTTTCCCACGGCTTAATAATATTAGTTTTTGGTTGTTGCCTCCTGCTTTAATATTATTATTAGGCTCCTCTTTCGTTGAACAAGGAGCTGGTACCGGGTGAACGATTTATCCTCCTTTAGCTGGCATTCAGGCCCATTCTGGCGGGGCGGTGGATATGGCTATTTTTAGTCTCCACTTAGCTGGGGCGTCCTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTTAATATGCGGGCTCCCGGGGTAACGTTGAATAGAATGCCCTTATTTGTGTGGTCTATCTTGATTACTGCTTTTTTATTATTATTGTCTTTGCCTGTATTAGCGGGGGCAATAACCATGCTTTTAACGGATAGAAACTTTAACACTACTTTCTTCGACCCTGCAGGGGGGGGGGATCCGATTTTATTTCAGCATTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tubastraea coccinea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Orange Cup Coral

Orange Cup Coral (Tubastraea coccinea) belongs to a group of corals known as large-polyp stony corals. This non-reef building coral extends beautiful translucent tentacles at night,[2] which gives the species its nickname, the Sun Coral. Tubastraea coccinea is heterotrophic and does not consume zooxanthellae like most corals do.

Habitat[edit]

Tubastraea coccinea (orange-cup coral) inhabit shaded vertical surfaces and caverns down to huge depths. Orange-cup-corals are also found in very cold water throughout the world. Orange-cup corals often dominate tropical habitats not occupied by other coral species, such as wrecks and cryptic reef habitats.[3] They also colonize artificial structures,[4] but experiments have demonstrated similar preferences for granite, cement, steel and tile.[5] In Brazil, they are most abundant in the shallow sub-tidal zone at shallow depths between 0m and 3m.[6]

Invasive Introduction and Range[edit]

Although Tubastraea coccinea (orange-cup coral) is listed on the Convention on International Trade in Endangered Species website and database, it often competes with other benthic invertebrates for substratum space. This may put native species at risk, particularly sponges and native corals. Local exclusion or extinction of such species may occur, and the removal of the native corals may reduce the production of the entire ecosystem, compromising ecosystem functions.

Tubastraea coccinea (orange-cup coral) is native to the Indo-Pacific region. However, it has been introduced to the Atlantic, Brazilian Exclusive Economic Zone, the Caribbean Sea, the Gulf of Mexico, New Zealand Exclusive Economic Zone, and the West African region as well.[7]

References[edit]

  1. ^ ITIS Standard Report Page: Tubastraea coccinea
  2. ^ Hawaii Coral Reef Network. 2005. Family Dendrophyllidae: Cup Corals.
  3. ^ Vermeij 2006
  4. ^ Fenner and Banks 2004, Sammarco et al. 2004
  5. ^ Creed & De Paula 2007
  6. ^ De Paula & Creed, 2004, 2005, Creed 2006
  7. ^ Encyclopedia of Life. "Details for: Orange Cup Coral". Encyclopedia of Life. Retrieved 2013-07-15. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!