Articles on this page are available in 1 other language: Spanish (13) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Diploria labyrinthiformis is a species of brain coral, so-named because of its appearance.The coral lives in shallow water habitats, such as reefs. A single-celled symbiotic algae lives within its cells and so it can only survive in water which receives enough light for photosynthesis to take place.Corals are very sensitive to environmental changes and coral reef populations are declining rapidly, with global warming one of the factors responsible.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The origin of the common name for the reef-forming coral, Diploria labyrinthiformis, "brain coral", is readily apparent: this species forms large clumps, 6 to 8 feet (2 to 2.5 meters) in diameter, with a deeply convoluted surface reminiscent of a human brain. It is brownish yellow in life (Voss 1980). This "brain" is actually a colony of tiny cnidarian polyps (sea anemone-like animals) that secrete a hard calcareous skeleton. The polyps feed by catching food with their tentacles, as well as obtaining nutrients from symbiotic photosynthesizing dinoflagellate "algae".

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, den Hartog, and Arneson, 1986 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Barrios-Su?z et al., 2002 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Diploria labyrinthiformis is a reef building coral that, along with many other coral species, helps to create a biodiversity-rich habitat for innumerable other coral reef animals. Diploria labyrinthiformis is identified by its characteristically brain-like hemispherical-shaped heads, and deep, interconnected polyp-bearing valleys which are separated by broad, grooved ridges" (Rossi-Snook, Wood, and Zeeh).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles and Bermuda.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Grooved brain coral, Diploria labyrinthiformis, grows in the Caribbean, Bahamas, southern Florida, and Bermuda. This species tends to grow on less solid and loose substrates of the ocean floor.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The genus Diploria is a conspicuous, common, and abundant reef-building group throughout the wider Caribbean. It is endemic to (i.e., found only in) the Atlantic-Caribbean (Weil and Vargas 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"It is found in the Caribbean, the Bahamas, southern Florida, and Bermuda" (Rossi -Snook, Wood, and Zeeh).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Diploria labyrinthiformis has very distinct valleys that contain polyps, and deeper grooves beneath the ridges. The valleys are 5-10 mm wide, up to 6 mm deep and u-shaped in a cross section. The ridges are wider than valleys, up to 15 mm, and have a concave profile with edges 2-4 mm higher than the rest of the ridge. Right angles of the plates, or septa, make it look like there are double combs in the valleys. Crests, or costae, of the septa form across the valley walls. Grooved brain coral tends to grow to longer lengths when inhabiting shallow waters. Colonies of D. labyrinthiformis can be one to two meters in diameter. Grooved brain coral can be a variety of colors including tans, yellows, and grays.

Range length: 2 (high) m.

Other Physical Features: ectothermic ; heterothermic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found from 1-43 m depth, and is most common from 2-15 m in lagoon and fore-reef environments (Goreau and Wells 1967).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range cited from 0-40 m, but typically occurs shallower from 3-10 m on spur and groove reef and fringing reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grooved brain coral is in the order Scleractinia, stony corals. The optimum temperature for adult Scleractinia coral is between 25 and 29 degrees Celcius; the absolute minimal temperature is 18 degrees Celcius. Because it has a single-celled symbiotic algae within its cells, grooved brain coral needs to be at depths where light can penetrate the water. As a result, this species has a depth limit of approximately 50 meters. Diploria labyrinthiformis grows throughout the year around Bermuda and in other areas off the Carribean. This coral can live in high areas of sediments. Members of the genus Diploria are found in high abundance on Bermuda's reefs when compared to other corals. This high abundance is due to the fact that genus Diploria has lower juvenile mortality rates than other coral groups.

Range depth: 50 (high) m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

  • Cohen, A., S. Smith, M. McCartney, J. Etten. 2004. How brain corals record climate:an integration of skeletal structure, growth and chemistry of Diploria labyrinthiformis from Bermuda. Marine Ecology Progress Series, 271: 147-158.
  • Logan, A., L. Yang, T. Tomascik. 1994. Linear skeletal extension rates in two species of Diploria from high-latitude reefs in Bermuda. Coral Reefs, 13: 225-230. Accessed June 22, 2011 at http://www.botany.ubc.ca/people/tomascik/PDF_7.pdf.
  • Smith, S. 1992. Patterns of coral recruitment and post-settlement mortality on Bermuda's reefs: comparisons to Caribbean and Pacific reefs. American Zooligist, 32: 663-673. Accessed June 22, 2011 at http://www.jstor.org/stable/3883647?seq=1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1323 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1068 samples.

Environmental ranges
  Depth range (m): 0 - 81
  Temperature range (°C): 25.995 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 35.091 - 36.613
  Oxygen (ml/l): 4.285 - 4.746
  Phosphate (umol/l): 0.020 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 81

Temperature range (°C): 25.995 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 35.091 - 36.613

Oxygen (ml/l): 4.285 - 4.746

Phosphate (umol/l): 0.020 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

D. labyrinthiformis (Linnaeus 1758) form crusts, plates, and sub-massive and massive boulders along a wide depth distribution (0–35 m) and is often abundant (Weil and Vargas 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Diploria labyrinthiformis depends primarily on suspension feeding of small marine invertebrates. This coral also has zooxanthellate algae. The symbiotic algae photosynthesize and supply the coral with nutrients and energy for calcification and growth.

Animal Foods: aquatic or marine worms; aquatic crustaceans; other marine invertebrates; zooplankton

Other Foods: microbes

Primary Diet: carnivore (Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

D. labyrinthiformis is in a sedimentary environment so because it can’t move around for food it has to depend on suspension to get nourishment. They prey on zooplankton and bacteria, by using their tentacles and extruded mesenterial filaments. They have nematocysts on their polyps, these nematocysts are triggered to capture and immobilize their prey. Also, mucus and cilia help in capturing and bringing food particles to the mouth (Rossi-Snook, Wood, and Zeeh). Furthermore, it also gets nourishment from symbiotic dinoflagellate algae and zooxanthellae, which is located in its polyps’ endodermal tissue layer (Rossi-Snook, Wood, and Zeeh).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Giant brain coral serves as homes for other organisms. Grazing by Diadema antillarum, the long-spined urchin, may benefit D. labyrinthiformis by reducing macroalgal growths. Zooxanthellate algae live within the cells of D. labyrinthiformis. The single-celled algae receives protection and feeds on coral waste, while the coral receives nutrients and energy from the algae.

Ecosystem Impact: creates habitat

Mutualist Species:

  • zooxanthellate algae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Common coral predators include gastropods, polychaetes, echinoids, asteroids, pycnogonids, and fishes, such as parrotfish.

Known Predators:

  • Gastropods
  • Polychaetes
  • Echinoids
  • Asteroids
  • Pycnogonids
  • Fish
  • Parrotfish

  • Sterrer, W. 1986. Wolfgang. 1986. Marine Fauna and Flora of Bermuda: A Systematic Guide to the Identification of Marine Organisms.. New York: John Wiley and Sons.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Occurs on most classes of marine hardbottom communities, including low-relief hardbottom communities, patch reefs, fringing reefs, spur and groove reefs, transitional reefs and deeper intermediate reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A84PET01FCUS: disease of unknown etiology. A89GOE01FCUS, A84LAS02FCUS, A90GHI01FCUS, A91WIL01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A77DOD01FCUS: more resistant to sedimentation than D. strigosa. A81ANT02FCUS, A75GAR01FCUS: seldom inflicted with black band disease. A92WIT01FCUS: no recruitment on eutrophicated reefs. A92COL01FCUS: salinity tolerance to 55 ppt for 12 h. A85HUB01FCUS: growth rate at .33 cm/yr. A15VAU01FCUS: growth rate measured at 6.4-9.2 mm/yr increase in diameter and 4.9-7.5 mm/yr increase in height.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution ecology

Diploria labyrinthiformis is a typical common coral of reefs and other shallow water habitats of the Atlantic (including Caribbean) region. Its fossil record is also entirely from this region. The oldest fossils are from the Pliocene epoch 5.33 million years ago.Like many other scleractinian corals in these environments, this coral is zooxanthellate (has single-celled symbiotic dinoflagellate algae living within its cells). As a result the coral can only survive in waters lit adequately for photosynthesis (not more than 10s of metres deep).Ecologically D. labyrinthiformis occurs in a wide range of environments. It is often found in marginal inshore conditions where few other species occur, but it is also a major reef-builder in optimum but slightly deeper reef areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There has been no research conducted on the communication and perception in D. labyrinthiformis. Many corals capture food with expanded tentacles suggesting a tactile response to the environment.

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Grooved brain coral has a broadcaster mode of development. Diploria labyrinthiformis is fertilized internally and then releases eggs into the ocean. The eggs hatch into swimming planktonic planulae larvae, which settle on an appropriate substrate, where asexual reproduction begins. Secondary polyps are formed, which develop to adult polyps. This species can grow at a rate of 3.5 millimeters per year.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of D. labyrinthiformis is unknown. However, members of the genus Diploria are found in high abundance on Bermuda's reefs when compared to other corals. This high abundance is due to the fact that genus Diploria has lower juvenile mortality rates than other coral groups.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Grooved brain coral is hermaphroditic, with an annual gametogenic cycle with a 10-11 month period for gonad (sex organ) development. The typical spawning season of grooved brain coral is from late May to late June. Spawning likely begins for this species as a result of environmental cues such as high air temperature, low number of solar hours per month, low wind velocity, and initiation of the rainy season.

Grooved brain coral has an average of four mature eggs and six spermatic cysts per fertile mesentery. Eggs and spermatic cysts are located towards the aboral (opposite the mouth) part of the mesentery.

Breeding season: The breeding season is from late May to late June.

Key Reproductive Features: seasonal breeding ; sexual ; asexual ; fertilization (Internal ); oviparous

There has been no known parental care for D. labyrinthiformis. Eggs are released after they are fertilized.

Parental Investment: pre-fertilization (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alvarado et al. (2004) studied the sexual reproduction of Diploria labyrinthiformis in Colombia and found that it is hermaphroditic (i.e., a single individual produces both eggs and sperm) and releases its gametes (eggs and sperm) in the spring, in contrast to the summer spawning of the other two Diploria species, D. strigosa and D. clivosa. Weil and Vargas (2010) studied the reproductive biology of all three species in Puerto Rico. primatily at the San Cristobal reef complex, where all three species had abundant large colonies. All three species were found to be simultaneous hermaphrodites (i.e., an individual produces both male and female gametes at the same time). Diploria strigosa and D. clivosa released gametes during August and/or September, but D. labyrinthiformis released its gametes in April and/or May (consistent with the findings of Alvarado et al. from Colombia). Of the three species, D. labyrinthiformis had the highest fecundity (an average of 36.5 eggs/polyp versus 27.2 for D. strigosa and 20.2 for D. clivosa). All three of these species are broadcast spawners, releasing their gametes into the water and providing no parental care (in some other coral species, known as brooders, fertilization and early development of larvae are internal, with larvae eventually released rather than gametes). Synchronized release of gametes (sperm and eggs) appears to be linked to lunar cycles, as well as other environmental cues.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A83FAD00FCUS: hermaphroditic within polyps with septae normally male or female. Suggested sequential hermaphrodite.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Growth form

The appearance of Diploria labyrinthiformis (Linnaeus, 1758) recalls the shape and pattern of the outer surface of brains of higher animals:
  • It forms large, rounded, often almost hemispherical colonies.
  • Its skeleton (corallum) consists of numerous, elaborately intergrown, meandering, valley-like structures (meandroid corallites) which often branch.


Valleys
Each valley is inhabited by a single long polyp with many mouths which are arranged serially or in a row along the valley, and all surrounded by a single shared set of tentacles. The valleys are:
  • 5-10mm wide
  • up to 6 mm deep
  • U-shaped in cross section
Valleys are separated from each other by thick ridges that are sometimes called ambulacra or, more strictly, inter-corallite tissue or coenosteum. Valley length can vary greatly within colonies, between colonies, and in different environments. The precise factors controlling valley branching, and the number and length of valleys, in relation to colony size are not yet understood.

Ridges
Ridges are usually as wide or wider than the valleys - up to 15mm wide. The profile across the top of the ridges is U-shaped (concave), with edges 2-4mm higher than the rest of the ridge.

Colonies
Coralla consist of two levels of coloniality (cf. modularity) as colonies grow by:
  1. increasing valley length, which is associated with the addition of new mouths at the ends of the valleys
  2. forming whole new valleys
Colonies can grow up to approximately 1m in diameter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Costasepta

What are costosepta?
In Diploria labyrinthiformis, numerous plates (septa) are aligned more or less at right angles to the valley walls, with 12-24 per cm of valley length. These give a double comb-like appearance to the valleys.The septa form crests (costae) across the walls. A single septum is continuous and integral with its respective costa. The complete structure is a costoseptum.

Appearance and pattern of costosepta
Costae slope down and across the coenosteal ridges that separate the valleys. Costae on the paired walls of the coenosteal ridges do not quite meet each other. Septa also slope steeply down into the central axis (fossa) of the valleys, but close to the fossa they are usually inflected into a less steep lobe-like segment (paliform lobe) before descending again to the fossa.Septa occur in 2-3 size orders, with respect to:
  • how far they extend towards the fossa
  • how high their costae are
Smaller sizes alternate more or less regularly with larger sizes. In the valleys smaller septa sometimes curve towards and join the larger ones. The longest septa reach as far as the valley axes. Opposing septa within a valley do not meet directly but merge into a more or less continuous structure (often called a columella, or more strictly, an axial structure). This axial structure occupies up to half the valley width and consists of:
  • small irregular plates
  • twisted elements running along the valley axis


Micro-morphology of costosepta
Costosepta are mostly imperforate except towards the fossa.They bear regular strong blunt teeth along all of their edges. These project more or less upward from the edges except close to the fossa where they project at various angles and contribute to the axial structure. Costoseptal faces bear small, fine spines or granules aligned in rows perpendicular to costoseptal margins. Rows may merge into fine ridges.

Internal structure of colonies:
  • Valley walls are formed by lateral thickening of adjacent costoseptae.
  • Valleys are floored by blistery plates (dissepiments) which occur repeatedly in vertical section through the colony.
The internal structure of the coenosteal ridges is similar.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Logan and Tomascik (1991) studied the growth rate of Diploria labyrinthiformis on several high latitude coral reefs around Bermuda. Growth rates showed an inverse curvilinear relationship with depth, with highest growth rates in shallow inshore waters and lowest at the edge of the Bermuda platform and on the adjacent fore-reef slope. Annual density bands formed seasonal couplets, with narrow, high density bands appearing to form in the spring-summer months and wider, low density bands over the rest of the year . Comparison of the extension rates of D. labyrinthiformis from Bermuda with published rates from lower latitudes indicates that reefs at lower latitudes (i.e., closer to the Equator) have higher extension rates than reefs at higher latitudes (Logan et al. 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

There are three described species currently placed in the genus Diploria. In addition to D. labyrinthiformis, these are D. strigosa, which is the most common and abundant of the three and has a growth habit similar to that of D. labyrinthiformis, and D. clivosa, which is mostly sub-massive and crustose with a distribution restricted to shallow, high energy, exposed reef platforms, back reef, and rocky habitats (Weil and Vargas 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diploria labyrinthiformis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATTTAGTTTTTGGTGTTTGAGCAGGTCTAATTGGGACTGCTTTTAGTATGCTTATACGACTGGAGCTATCTGCGCCAGGCGCTATGTTAGGGGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTGTTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTAGCTGGGGTCTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCTCCTGGTATTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTATTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGGGGAGATCCTATTTTATTCCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diploria labyrinthiformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 4 specimens with morphological vouchers housed at Australia Museum and Museum and Art Galleries of the Northern Territory
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread in the Caribbean and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diploria labyrinthiformis is listed as least concern on the IUCN Red List.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widespread distribution in the tropical western Atlantic and occurs on most classes of marine hardbottom communities. Considered less threatened due to isolated reports of disease and moderate sensitivity to sedimentation stress.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in most reef environments, but at low abundances. In certain localized areas, this species can be the most abundant brain coral. There are no known instances of widespread population declines, but localized mass mortality events have been recorded (e.g., Bruckner and Bruckner 1997).

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Information is needed on the status and trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threat to this species is black band disease and white plague, with localized impacts from bleaching, bioerosion by sponges and other organisms, hurricane damage, and high sedimentation. This species generally exhibits high rates of recruitment, but new recruits may sustain high mortality due to algal overgrowth.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Considered less threatened with reports of disease, moderate resistance to sedimentation but low tolerance to eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes.

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., MPAs, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting. Recommended conservation measures include population surveys to monitor the effects of collecting for the aquarium trade, especially in Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Data needed on recruitment patterns. Information needed on susceptibility to eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous occurrences in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys should be installed in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative impacts of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Grooved brain coral helps to make up the coral reefs that serve as diving attractions.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Cohen et al. (2004) investigated the potential for using chemical and microstructural analysis of the skeletons of brain corals (Diploria labyrinthiformis) to provide proxy records of wintertime sea surface temperature (SST) variability in the subtropical North Atlantic. Although this species has a slow growth rate (less than one half of Pacific Porites species) and complex skeletal architecture, D. labyrinthiformis is an appealing potential archive of paleo-SST because of its abundance throughout the Caribbean; its tendency to build massive, long-lived colonies; and the presence of strong annual growth bands in the skeleton (Cohen et al. 2004).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!