Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

The scleratinian (stony) coral Diploria strigosa is the most common of the three Diploria species, all of which are endemic to (i.e., found only in) the Atlantic-Caribbean region. This species form crusts, plates, and sub-massive and massive boulders across a wide depth distribution (0 to 35 meters) and is abundant across most reef habitats in the Caribbean region. It is a simultaneous hermaphrodite (i.e., a single individual functions as both male and female) and a broadcast spawner, releasing large, orange gamete (egg and sperm) bundles during the summer, with a single gametogenic (gamete-producing) cycle per year. In broadcast spawners, such as Diploria strigosa, gametes are released into the water and fertilization takes place in the water column. (In the small minority of coral species [although majority of non-stony coral species] with internal fertilization, known as brooders, sperm are released into the water and swim to another polyp containing the eggs, enter through the mouth, and fertilize the eggs; larvae then develop within the polyps.) (Weil and Vargas 2010 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, den Hartog, and Arneson, 1986 YES MINERAL ARAGONITE
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Barrios-Su?z et al., 2002 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

“Colonies form smoothly contoured plates to hemispherical domes, up to 1.8 m in diameter. The surfaces of the colonies have long valleys, which are often connected and usually convoluted, except near the colony's edge. Ridges evenly rounded, usually without a top groove, although occasionally with an extremely fine groove, especially near the colony's edge. The costae between adjacent corallites are continuous, and all costae are equal in thickness. Valleys are highly convoluted and often interconnected (Symmetrical brain coral” (Diploria strigosa).

Color- Green to brown, bluish gray and yellow- brown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Belize, Bermuda, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Guatemala, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico, West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles and Bermuda. B71SMI01FCUS: Bermuda, Florida, Bahamas, West Indies. B78COL01FCUS: Caribbean, northern Gulf of Mexico. A82CAI01FCUS: Belize. B86STE01FCUS, A82DOD01FCUS, A85FRI01FCUS, A74SCO01FCUS, A78DRY01FCUS: Bermuda. A84BRI01FCUS, A83FAR01FCUS, A88TUN01FCUS: Gulf of Mexico. A81JOR01FCUS, A88FEN00FCUS: Mexico. A74KUH01FCUS, B82ZLA01FCUS: Cuba. A59GOR01FCUS, A67GOR01FCUS, A81LID01FCUS, A87LID00FCUS: Jamaica. A63ALM01FCUS, A76LOY01FCUS, A70PRE01FCUS: Puerto Rico. A74LEW01FCUS, A79DUN01FCUS, A83ROG01FCUS, A84ROG00FCUS, A87TOM01FCUS, A72ROB01FCUS: lesser Antilles. A74SCA01FCUS, A78FOC01FCUS: Bonaire. B84JAA00FCUS, A82DAV00FCUS, A89GLY00FCUS, A85BUR00FCUS, A85WHI01FCUS, J88WHE00FCUS, J89JAA00FCUS: southern Florida. A84LAS02FCUS: Panama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The genus Diploria is a conspicuous, common, and abundant reef-building group throughout the wider Caribbean. It is endemic to (i.e., found only in) the Atlantic-Caribbean (Weil and Vargas 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

D. strigosa is very common on the reefs of the Bahamas, Carribean, and Bermuda (Evans).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Diploria strigosa forms medium-sized, hemispherical, yellow, brown, or greenish colonies. Hills are rounded (not sharp) and almost as wide as valleys--to 4.5 mm--without depressions. 15-20 septa per cm. (Kaplan 1982)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Lookalikes

Diploria clivosa is usually encrusting, rarely hemispherical. Hills are sharp and narrow--to 1.5 mm wide (valleys to 6 mm); alternating wide and narrow septa, ~35/cm; not found in Bermuda or Brazil. (Kaplan 1982)

Diploria labyrinthiformis has flat, wide hills--to 2 cm wide, with much narrower valleys. A depression runs the length of each hill. 14-17 septa per cm. Common in rear zone. (Kaplan 1982)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is the most widely distributed species in this genus occurring in exposed locations, protected back reef environments and in bays with high sediment loads. It is found from 0.5-55 m depth (Goreau and Goreau 1973); however, it is most common above 10 m (A. Bruckner pers. comm.). In certain environments, like in reef-crest environments, it can form monospecific stands.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from the nearshore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4287 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3544 samples.

Environmental ranges
  Depth range (m): 0 - 109.375
  Temperature range (°C): 19.819 - 28.067
  Nitrate (umol/L): 0.024 - 8.028
  Salinity (PPS): 34.667 - 36.743
  Oxygen (ml/l): 3.986 - 4.773
  Phosphate (umol/l): 0.020 - 0.379
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 109.375

Temperature range (°C): 19.819 - 28.067

Nitrate (umol/L): 0.024 - 8.028

Salinity (PPS): 34.667 - 36.743

Oxygen (ml/l): 3.986 - 4.773

Phosphate (umol/l): 0.020 - 0.379

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range from 0-55 m, but typically occurs between 2-15 m on most reef classes.

A67GOR01FCUS: 0 to 40 m, typically 3 to 10 m depth. B86STE01FCUS: 1 to 8 m, inner/outer reefs, muddy bays. A82CAI01FCUS: 0 to 2 m, back reef. A85WHI01FCUS, J88WHE00FCUS: fore reef and spur and groove (5-15 m). B84JAA00FCUS: transitional reefs. A84BRI01FCUS: 15-55 m at Flower Gardens. A88JAA01FCUS: dominant patch reef species. A89DAH00FCUS: fore reef (5 m).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diploria strigosa forms crusts, plates, and sub-massive and massive boulders along a wide depth distribution (0 to 35 meters), and is abundant across most reef habitats in the Caribbean (Weil and Vargas 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabit many marine environments, down to 40 m (Symmetrical brain coral (Diploria strigosa).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

The encrusting and excavating Caribbean sponge Cliona tenuis competes for space with the coral Diploria strigosa by aggressively undermining and displacing live coral tissue (López-Victoria et al. 2006).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

1000 - 2500 individuals

Comments: Limited to reef-class communities such as patch reefs, fringing reefs, spur and groove reefs, transitional reefs and deeper intermediate reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A84PET01FCUS, A89GLY00FCUS, A75GAR01FCUS: black band disease, protozoan parasites. A84LAS02FCUS, A90GHI01FCUS, A91WIL01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A92COL01FCUS: salinity tolerance to 55 ppt for 12 h. A90TOM01FCUS: growth rate at .32-.45 cm/yr. A84BRI01FCUS: growth rate .5 cm/yr at 21 m. A15VAU01FCUS: growth rate at .59-1.98 cm/yr increase in diameter and .46-1.0 mm/yr increase in height. A72OTT01FCUS: fed upon by Coralliphila abbreviata and Hermodice caruncullata.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

In a study of seven "massive" Caribbean corals, Soong (1993) identified major differences in reproductive behavior between species with large maximum colony size (>100 cm2 in surface area), including Diploria strigosa, and species with small maximum colony size. The four large species studied broadcast gametes during a short spawning season and had a relatively large "puberty" size. The two smaller-sized and one medium-sized species brooded larvae during an extended season (year round in Panama) and had a puberty size of just 2 to 4 cm2.

Prior to the early 1980s, for over 200 years, all corals were believed to be viviparous (brooding). It is now known that most reef-building corals release, or "broadcast", eggs and sperm into the water column during periodic and often synchronous spawning events. For decades researchers have speculated about and worked to identify environmental entrainment factors that might influence sexual reproduction and the eventual release of gametes. This synchronization is generally believed to operate on at least three interrelated temporal levels: (1) the time of the year; (2) the lunar cycle; and (3) the time of night. It is clear that nighttime is required for gamete release, but a consistent global relationship between lunar phase and the timing of spawning is less clear, given that most corals on the Great Barrier Reef in Australia spawn at neap tides, while the same species in southern Japan spawn at spring tides. It has seemed reasonable to assume that the time of the year for gamete release is linked to optimal sea surface temperature (SST). van Woesik et al. (2006), however, have argued that solar insolation (energy from the sun), is a better predictor of gamete production for many corals.They tested this hypothesis using data for 12 species of corals distributed throughout the Caribbean (tropical west Atlantic), including Diploria strigosa. Regarding temperature, they found that the cumulative dose of SST measured through time and the rate of change in temperature correlated poorly with the timing of coral spawning, although the average temperature during the month of spawning was significantly correlated with spawning. For solar insolation, they found that the rate of change and the cumulative response of solar insolation cycles was a better predictor of gamete release, although solar insolation intensity at the time of spawning was not. All of the coral species they examined showed highly significant positive relationships between spawning date and the cumulative dose of solar insolation, and 11 of 12 species, including D. strigosa, showed a significant response to the rate of change in solar insolation. Solar insolation and temperature are obviously related phenomena since solar irradiance ultimately drives SST, but because of the high specific heat capacity of water, maximum SST generally lags 1 to 2 months (or more) behind maximum solar insolation. Time delays in SST fluctuations are latitudinally predictable but vary with cloud-cover and windstrength. van Woesik et al. concluded that solar insolation influences the reproductive schedules of Caribbean corals, but water temperatures must be optimal (28–30 C) to allow maturation and gamete release. (van Woesik et al. 2006 and referencess therein)

Broadcast spawning by corals is a tightly synchronized process characterized by coordinated gamete release within 30 to 60 minute time windows once per year. Vize (2006) asserts that for shallow water corals, annual water temperature cycles set the month, lunar periodicity the day, and sunset time the hour of spawning. This tight temporal regulation is critical for achieving high fertilization rates in a pelagic environment. Given the differences in light and temperature that occur with depth and the importance of these parameters in regulating spawn timing, Vize notes that it has been unclear whether corals in deeper water can respond to the same environmental cues that regulate spawning behaviour in shallower coral. Vize used a remotely operated vehicle to monitor coral spawning activity (including that of Diploria strigosa) at the Flower Garden Banks (northwest Gulf of Mexico) at depths from 33 to 45 m, All recorded spawning events were within the same temporal windows as shallower conspecifics. These data indicate that deep corals at this location either sense the same environmental parameters, despite local attenuation, or communicate with shallower colonies that can sense such spawning cues.

In a study in Puerto Rico, D. strigosa spawned in August and/or September. Development of oocytes (egg-producing cells) began in October–November, between 5 and 7 months before spermatogenesis (sperm production). Development of spermaries (sperm-producing structures) started 6–7 months after oogenesis, in May to June. Spermatogenesis lasted 3 to 5 months, with sperm cells maturing rapidly and reaching full maturity at the same time as the eggs, in late July and August. A high proportion of colonies had mature spermatocytes and oocytes 4 days after the full moons of both July 28 and August 30, 1999, indicating that in the year of this study, a split spawning occurred. No mature gametes were found in these colonies in tissue samples collected in September of 1999. Spawning occurred after 11 p.m. on nights 9 and 10 after the full moon for D. strigosa. (47.6 and 50.03 eggs/polyp in 1999 and 2000, respectively). There was no significant correlation between colony size and mean polyp fecundity for D. strigosa. Even the smallest colonies sampled (140 cm2) were sexually mature, and there was high variability in fecundity; minimum reproductive size must therefore be below this size.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A85WYE01FCUS: hermaphroditic simultaneous. Oogenesis begins in late November and January, with gamete release in early September. A86SZM00FCUS: gametogenesis for females from mid-December to June and for males from June-July. Spawning season in mid-August with low reported recruitment rates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

D. strigosa reproduces sexually by a process called gametogenisis. They can also reproduce asexually by fragmentation. Moreover, they are hermaphrodites they are able to produce both male and female gametes. "D. strigosa uses the broadcast spawning method of fertilization; this is when the sperm and eggs combine in the water column or at the surface as opposed to brooding where fertilization occurs within the maternal polyp" (Evans, Wood, and Zeeh). Studies have shown that D. strigosas' spawning season occurs for a short time in mid August and spawning mainly occurs at night. Temperatures for peak fertilization are between 25 to 29 degrees Celsius and if the temperatures rise over 30 degrees Celsius larval developmental problems begin to occur" (Evans).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Development

Bassim et al. (2002) studied the effects of water temperature on the reproduction of Diplora strigosa in the Flower Garden Banks reefs, a set of coral reefs in the northern Gulf of Mexico, ~110 miles offshore of Texas (U.S.A.): Although elevated seawater temperatures had no apparent effect on success of gametic fertilization in this species, the rate and progress of embryonic larval development were significantly negatively affected. Higher temperatures commonly produced numerous developmental aberrations during the development of the larvae. Thus, although fertilization rates can remain high under high temperature conditions, if temperatures remain high for several days, embryonic development and larval viability may be expected to decrease dramatically. The authors propose that the success of coral larval development may be diminished in areas where abnormally high sea surface temperatures occur during the spawning season.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Diploria strigosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAGTTTTTGGTGTTGGAGCAGGTCTAATTGGGACTGCTTTTAGTATGCTTATACGACTGGAGCTATCTGCGCCAGGCGCTATGTTAGGGGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTGTTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCGCCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTAGCTGGGGTCTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCTCCTGGTATTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTATTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGGGGAGATCCTATTTTATTCCAACATTTATTTTGGTTTTTTGGGCATCCTGAAGTTAATATTTTAATTTTGCCTGGTTTTGGTATGATTTCTCAAATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Diploria strigosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Academy of Natural Sciences, Philadelphia
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread in the Caribbean and common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widespread distribution in the tropical western Atlantic but limited to reef communities. Moderately high sensitivity to eutrophication but lower sensitivity to sedimentation and salinity fluctuations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The most common of all Diploria species, and the dominant coral in Bermuda. There are no known instances of widespread population declines, although localized declines have taken place in some areas due to disease (Bruckner and Bruckner 1997).

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Information is needed on the status and trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Of the three species of Diploria, this is the most susceptible to black band disease and white plague. Predation by Stegastes planifrons (Three-spot Damselfish) and Sparisoma viride (Stoplight Parrotfish) is also a major threat (Bruckner and Bruckner 1998, 2004). This species is also susceptible to localized impacts from bleaching, bioerosion by sponges and other organisms, hurricane damage, and high sedimentation. This species generally exhibits high rates of recruitment, but new recruits may sustain high mortality due to algal overgrowth.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Considered less threatened due to low sensitivity to sedimentation but moderate sensitivity to eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes.

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., MPAs, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting. Recommended conservation measures include population surveys to monitor the effects of collecting for the aquarium trade, especially in Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Data needed on recruitment patterns and susceptibility to sedimentation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous occurrences in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys need to be installed in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

Hetzinger et al. (2006) studied the geochemistry of the fast-growing Diploria strigosa, examining a 41-year record of geochemical variations. They were able to correlate specific geochemical changes in the coral with instrumental sea surface temperature (SST) on both monthly and mean annual time scales and with local air temperature on a mean annual scale.The geochemical coral proxies they used were highly correlated with annual and seasonal mean time series of major SST indices in the northern tropical Atlantic. Furthermore, the coral proxies capture the impact of the El Nino Southern Oscillation on the northern tropical Atlantic during boreal spring. Thus, Hetzinger et al. suggest that fast-growing Diploria strigosa corals are a promising new archive of historical climate data for the Atlantic Ocean.

Zamudio-Zamudio et al. (2003) analyzed the building materials used in the construction of building materials of the Fortress of San Juan de Ulua (16th century) and of the Portal de Miranda (18th century) in Veracruz City, Mexico. One of these materials, known as "mucara" stone, was analyzed by means of stereoscopic and scanning electron microscopy, X-ray diffraction, neutron activation, atomic absorption spectrometry, X-ray fluorescence, and thermogravimetry and was identified as the skeleton of the coral Diploria strigosa, whose main component is the mineral aragonite (a crytal form of calcium carbonate, CaCO3). Many of the buildings in Veracruz City were built with mucara stone (Zamudio-Zamudio et al. 2003 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Diploria strigosa

Diploria strigosa, the symmetrical brain coral, is a colonial species of stony coral in the family Faviidae. It occurs on reefs in shallow water in the West Atlantic Ocean and Caribbean Sea. It grows slowly and lives to a great age.

Contents

Description

Close up view of ridges and valleys on the surface of the coral

The symmetrical brain coral forms smooth flat plates or massive hemispherical domes up to 1.8 metres (5 ft 11 in) in diameter. The surface is covered with interlinking convoluted valleys in which the polyps sit in cup-shaped depressions known as corallites. Each of these has a number of radially arranged ridges known as septae which continue outside the corallite as costae and link with those of neighbouring corallites. The ridges separating the valleys are smoothly rounded and do not usually have a groove running along their apex as does the rather similar grooved brain coral (Diploria labyrinthiformis). The coral has symbiotic dinoflagellate alga called zooxanthella in its tissues and it is these which give the coral its colour of yellowish or greenish brown, or occasionally blue-grey. The valleys are often a paler or contrasting colour.[2][3]

Distribution and habitat

The symmetrical brain coral grows in shallow parts of the Caribbean Sea, the Bahamas, Bermuda, Florida and Texas. It is probably the most widespread of the brain corals (Diploria ssp.) and not only occurs on reefs but also sometimes on muddy stretches of seabed where not many other corals flourish.[2] It grows at depths down to about 40 metres (130 ft).[3]

The fossilised remains of Diploria strigosa have been found alongside those of other massive corals, Diploria clivosa, Siderastrea siderea and Solenastrea bouroni, in marine deposits in Río Grande de Manatí, Puerto Rico that date back to the Pleistocene.[4]

Biology

The symmetrical brain coral grows very slowly adding about 1 centimetre (0.39 in) to its diameter in a year. This means that a large specimen over a metre (yard) across is at least a century old. In the day time the polyps retract inside their corallites but at night they extend their ring of tentacles and feed on zooplankton. The coral also benefits from the photosynthetic products produced by the zooxanthellae.[2]

References

  1. ^ van der Land, Jacob (2012). "Diploria strigosa (Dana, 1846)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=289827. Retrieved 2012-09-10.
  2. ^ a b c Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 247. ISBN 0-86622-875-6. 
  3. ^ a b "Symmetrical brain coral (Diploria strigosa)". Interactive Guide to Caribbean Diving. Marine Species Identification Portal. http://species-identification.org/species.php?species_group=caribbean_diving_guide&id=310. Retrieved 2012-09-10.
  4. ^ Geological Survey (US) (1959). U.S. Geological Survey professional paper, Issue 317. G.P.O. p. 123. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!