Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Barrios-Su?z et al., 2002 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Belize, Bonaire, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Guatemala, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Mexico, Mozambique, Nicaragua, Panama, Puerto Rico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, Gulf of Mexico, Florida, the Bahamas, and Bermuda.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widepsread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles, Central America, Brazil and Bermuda. B71SMI01FCUS: Bermuda, Florida, Bahamas, West Indies. B78COL01FCUS: Caribbean, Bermuda, northwestern Gulf of Mexico. A84BRI01FCUS, A88NEL01FCUS, A83FAR01FCUS, A88TUN01FCUS: Gulf of Mexico. A82CAI01FCUS: Belize. A85REE01FCUS, A88LAN01FCUS: Bahamas. A59GOR01FCUS, A67GOR01FCUS, A73WEL01FCUS, A79FOS01FCUS, A85HUG01FCUS, A81LID01FCUS, A87LID00FCUS, A90GAT01FCUS, A82DAL01FCUS: Jamaica. A88FEN00FCUS, A81JOR01FCUS: Mexico. B82ZLA01FCUS, A74KUH01FCUS: Cuba and Brazil. A76LOY01FCUS, A81DOD01FCUS, A63ALM01FCUS, A70PRE01FCUS, A89GOE01FCUS: Puerto Rico. A87TOM01FCUS, A79DUN01FCUS, A83ROG01FCUS, A84LEW01FCUS, A76GOO01FCUS, A68ADA01FCUS, A85HUB01FCUS, A72ROB01FCUS: lesser Antilles. A74SCA01FCUS, A79BAK01FCUS, A78FOC01FCUS, A75BAK01FCUS, A77BAK01FCUS: Curacao and Bonaire. A84LAS02FCUS: Panama. A83RAM01FCUS: Venezuela. A85COR01FCUS: Costa Rica. A92KNO01FCUS: Panama. B86STE01FCUS, A85FRI01FCUS, A74SCO01FCUS, A82DOD01FCUS, A78DRY01FCUS: Bermuda. A73GOL00FCUS, B84JAA0FCUS, A88JAA01FCUS, J89JAA00FCUS, J88WHE00FCUS, A85BUR00FCUS, A85WHI01FCUS, A79JAA00FCUS, A85CUR01FCUS, A77JON01FCUS, A82DAV00FCUS, A87DUS00FCUS, A85DUS01FCUS, A77DUS00FCUS: southern Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a common species. M. annularis is found from 0.5-82 m (Reed 1985), and is often the most abundant coral from 1-10 m, especially in semi-protected reef environments; it is frequently a dominant species of lagoons and upper reef slopes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8164 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6179 samples.

Environmental ranges
  Depth range (m): 0 - 103.875
  Temperature range (°C): 19.819 - 28.067
  Nitrate (umol/L): 0.115 - 8.028
  Salinity (PPS): 34.667 - 36.613
  Oxygen (ml/l): 3.986 - 4.773
  Phosphate (umol/l): 0.042 - 0.379
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0 - 103.875

Temperature range (°C): 19.819 - 28.067

Nitrate (umol/L): 0.115 - 8.028

Salinity (PPS): 34.667 - 36.613

Oxygen (ml/l): 3.986 - 4.773

Phosphate (umol/l): 0.042 - 0.379

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range from .3-82 m, but typically occurs between 3-45 m on all reef classes.

A67GOR01FCUS: 0.3 to 80 m, typically 3 to 45 m. A73GOL00FCUS: patch reefs (9 m), outer reef platform (16-20 m), reef slope (20-30 m) and fore reef (30+ m). A82CAI01FCUS: all reef environments. B86STE01FCUS: 1 to 30 m, inner and outer reefs, open inshore waters. B84JAA00FCUS, J88WHE00FCUS, A85BUR00FCUS, A85WHI01FCUS: bank reefs, spur and groove reefs. A76LOY01FCUS: reef flat and fore reef. A87TOM01FCUS: reef flat, spur and groove and back reef. A88JAA01FCUS: dominant patch reef species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Occurs on a wide variety of reef community classes, including low-relief hardbottom communities, patch reefs, fringing reefs, spur and groove reefs, transitional reefs, deeper intermediate reefs and deep reef slopes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A84PET01FCUS, A90WIL01FCUS, A81ANT02FCUS, A77DUS00FCUS, A83RAM01FCUS: black band disease, algal overgrowth due to damselfish. A84LAS02FCUS, A89GOE01FCUS, A90GHI01FCUS, A90WIL01FCUS, A90HAY01FCUS, A79JAA00FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A92COL01FCUS: tolerance to salinity below 43 ppt. A82DAL01FCUS, A85PAS01FCUS, A74ALL01FCUS: moderate sensitivity to sedimentation and inverse relation between growth and resuspension of bottom sediments. A82ROB00FCUS: used as temperature stress indicator. A87TOM01FCUS: growth rate faster on less polluted reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

A86SZM00FCUS, A85SZM01FCUS, A91SZM01FCUS: hermaphroditic protogynous with gametogenesis for females between mid-may to July and for males from July to August. Spawning takes place from mid-August to September with low reported recruitment rates (A79BAK01FCUS). A91TOM02FCUS: recruitment absent on eutrophication reefs on the west coast of Barbados. High sexual recruitment on non-polluted spur and groove reef communities.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Montastraea annularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAAAAATAATTATTTTATCCGTTGGGTTTTCTCTACAAATCATAAAGACATAGGAACTTTATATTTAGTTTTTGGTGTTGGAGCAGGTCAAATTGGGACTGCTTTTAGTATGCTTATACGATTGGAGCTTTCTGCGCCAGGCGCGATGTTAGGTGATGATCATCTTTATAATGTAATTGTAACAGCACATGCTTTGATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGGTTTGGAAACTGGCTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGTTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTGGCTGGGGTTTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTCTCTTTTAATAGAATGCCCTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTGTTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGGGATCCTATTTTGTTCCAACATTTATTTTGGTTTTTTGGGCACCCCGAAGTTTATATTTTAATTTTGCCTGGTTTTGGTATAATTTCTCAAATAATACCTACTTTTGTTGCTAAAAAACAAATTTTTGGGTATTTAGGGATGGTTTATGCGATGCTTTCAATTGGTCTTCTTGGGTTTATTGTTTGAGCCCATCATATGTTTACAGTTGGGATGGATGTGGACACAAGAGCTTATTTTACTGCGGCAACTATGATTATTGCCGTGCCAACTGGAATAAAAGTGTTTAGTTGGTTGGCCACTATTTATGGTGGAACTTTAAGATTAGACACTCCTATGCTTTGGGCTATGGGTTTTGTTTTTTTATTTACAGTAGGCGGTTTAACAGGGGTTGTATTAGCAAATAGTTCTCTTGATATTGTTCTACATGACACATATTATGTAGTTGCACATTTTCATTATGTTCTTTCTATGGGGGCTGTCTTTGCTATTTTTGGGGGGTTTTATTATTGAATTGGGAAAATTAGTGGATATTGTTATAACGAACTCTATGGTAAGGTCCATTTTTGGTTAATGTTTATAGGGGTTAATTTGACGTTTTTCCCCCAACACTTTTTGGGTTTGACAGGTTTTCCAAGACGATATTCGGACTTTGCGGATAGCTTTGCTGGTTGGAATTTAGTTAGCTCCTTGGGCTCTATAATTTCCATTGTAGGAGTCGTTTGGTTTCTATATATTGTTTATGAGATTTATGTTCGAGAGGAGCCATTTATTGGTTGAAGAGAGGACACGGACTCGAGCTGGGCTTCTTTAGAGTGAGCGCATGTTTCTCCCCCTTTATCTCATACTTATAATGAGCTTCCTTTTGTTATAAAAATACAAACAGATCATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Montastraea annularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2ace

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
This species is listed as Endangered as the species is believed to have undergone a decline exceeding 50% over the past 30 years due in particular to the effects of disease and bleaching, as well as other anthropogenic-related factors. Current rates of mortality are exceeding growth and recruitment, and current threats are increasing. Due to their extreme longevity, low rates of recruitment and long generation times, scope for recovery of populations is limited. If current trends continue, this species may warrant listing in a higher category of threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread distribution in the tropical western Atlantic and is abundant on most classes of reef communities. Species threats listed include chronic sedimentation, disease, bleaching and eutrophication but is moderately tolerant to environmental perturbation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the last 20 years, there has been a severe decline in the overall cover and abundance of M. annularis in several parts of the Caribbean. For example, 90% of the cover of the species was lost in the coastal waters off Jamaica from 1980 through 1994 (Hughes 1994). Off the coast of eastern Puerto Rico, declines in cover were recorded at between 40 and 60% (Hernandez-Delgado 2005), at around 40% off south-eastern Puerto Rico (E. Weil pers. comm.), 50% off Mona Island (Bruckner and Bruckner 2006), and 72% in St John, US Virgin Islands, between 1988 and 1999 (Edmunds and Elahi 2007). Dustan and Halas (1987) observed a 31% decline in cover of M. annularis complex on Carysfort Reef (Key Largo) between 1975-1982, with a 21% decline in colony size.

Off the northern coast of Belize, declines upwards of 90% were recorded specifically for M. annularis (Burke et al. 2004).

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on generation length estimates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Information is needed on the status and trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threats to the species are infectious diseases (white plague, yellow band and black band disease) and bleaching. Other threats include predation by Sparisoma viride (Stoplight Parrotfish), hurricane damage, and loss of habitat at the recruitment stage due to algal overgrowth and sedimentation, as well as localized impacts due to bioerosion by sponges and other organisms, and other diseases.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Not considered threatened due to moderate tolerance to sedimentation but incidence of disease and bleaching well documented.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Data needed on recruitment patterns and susceptibility to eutrophication, disease and sedimentation for each subspecies or form.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous occurrences in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys need to be installed proximate to populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Montastraea annularis

Montastraea annularis, commonly known as the boulder star coral, is a species of coral that lives in the western Atlantic Ocean and is the most thoroughly studied and most abundant species of reef-building coral in the Caribbean to date.[1] It also has a comprehensive fossil record within the Caribbean.[2][3] This species complex has long been considered a generalist that exists at depths between 0 and 80 meters[4] that grew into varying colony shapes (heads, columns, plates) in response to differing light conditions.[5] Only recently with the help of molecular techniques has M. annularis been shown to be a complex of at least three separate species.[6][7][8] Those species are divided into M. annularis, M. faveolata, and M. franksi.

A related species is M. cavernosa, which has larger polyps.

References

  1. ^ Dawson, J. P. 2006. "Quantifying the colony shape of the Montastraea annularis species complex." Coral Reefs. Vol. 25:383-389.
  2. ^ Budd, A. F.; Stemann, T. A.; Johnson, K. G. 1994. "Stratigraphic distributions of Neogene to recent Caribbean coral reefs." J Paleontol. Vol. 68:951-977.
  3. ^ Budd, A. F.; Klaus, J. S. The origin and early evolution of the Montastraea 'annularis' species complex (Anthozoa: Scleractinia)." J Paleontol. Vol. 75:527-545.
  4. ^ Connell, J. H. 1978. "Diversity in tropical rain forests and coral reefs." Science. Vol. 199:1302-1310.
  5. ^ Graus, R. R.; Macintyre, I. G. 1976. "Control of form in colonial corals: computer simulation." Science. Vol. 193:895-897.
  6. ^ Knowlton, N.; Weil, E.; Weigt, L. A.; Guzman, G. M. 1992. "Sibling species of Montastraea annularis, coral bleaching, and the coral climate record." Science. Vol. 255:330-333.
  7. ^ Weil, E.; Knowlton, N. 1994. "A multi-character analysis of the Caribbean coral Montastraea annularis (Ellis and Solander 1786) and its two sibling species, M. faveolata (Ellis and Solander 1786) and M. franksi (Gregory 1895)." Bulletin of Marine Science. Vol. 55:151-175.
  8. ^ Knowlton, N.; Budd, A. F. 2001. "Recognizing coral species present and past. In: Jackson JBC, Lidgard, S.; McKinney, F. K. (eds) "Evolutionary Patterns: growth, form, and tempo in the fossil record
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species may be composed of up to three subspecies or forms (see Knowlton et al., 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!