Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Moderately widespread distribution in the tropical western Atlantic, including southern Florida, Bahamas, Mexico, Jamaica, Cuba, Puerto Rico, Lesser Antilles, Curacao and Bonaire.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, southern Gulf of Mexico, Florida, and the Bahamas. It may be absent from portions of the south-western Caribbean (Panama?).

This species is reported to have been eliminated from Panama, even though recent fossils (<1,000 year old) have been found.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Overall depth range from 2-20 m, but typically occurs from 3-8 m on shallow spur and groove reefs and fringing reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Colonies are found on flat or gently sloping back reef and fore reef environments from 1-25 m depth, most commonly from 5-15 m (Goreau and Wells, 1967; E. Weil and A. Bruckner pers. comm.). Colonies do not occur in extremely exposed locations. This colony is resistant to heavy wave surge; however, colonies will occasionally topple due to bioerosion at the bases. Upper portions of the colonies generally survive, and the colony produces multiple new pillars which continue to grow upward (A. Bruckner pers. comm.).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 93 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 1.5 - 23
  Temperature range (°C): 26.007 - 27.998
  Nitrate (umol/L): 0.115 - 2.891
  Salinity (PPS): 35.091 - 36.487
  Oxygen (ml/l): 4.330 - 4.748
  Phosphate (umol/l): 0.049 - 0.214
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 1.5 - 23

Temperature range (°C): 26.007 - 27.998

Nitrate (umol/L): 0.115 - 2.891

Salinity (PPS): 35.091 - 36.487

Oxygen (ml/l): 4.330 - 4.748

Phosphate (umol/l): 0.049 - 0.214

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 4 - 62.5
  Temperature range (°C): 26.704 - 27.668
  Nitrate (umol/L): 0.161 - 0.781
  Salinity (PPS): 35.207 - 36.261
  Oxygen (ml/l): 4.645 - 4.736
  Phosphate (umol/l): 0.020 - 0.125
  Silicate (umol/l): 1.354 - 2.209

Graphical representation

Depth range (m): 4 - 62.5

Temperature range (°C): 26.704 - 27.668

Nitrate (umol/L): 0.161 - 0.781

Salinity (PPS): 35.207 - 36.261

Oxygen (ml/l): 4.645 - 4.736

Phosphate (umol/l): 0.020 - 0.125

Silicate (umol/l): 1.354 - 2.209
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

1000 - 2500 individuals

Comments: Limited to shallow reef communities such as fringing reefs, spur and groove reefs and transitional reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

P91PET01FCUS: protozoan parasites. A81ANT02FCUS: never reported with white band or black band disease. A15VAU01FCUS: reported growth rate of 10.4 mm/yr increase in height and 7 mm/yr increase in diameter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

A86SZM00FCUS: gonochoric protogynous with external development. Gametogensis for females from May-August and for male colonies from mid-June to August. Spawning may take place in mid-August. A92WIT01FCUS: low reported recruitment rates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrogyra cylindrus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTGCTTTTAGTGTGCTTATACGACTGGAGCTATCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGATTTGGAAATTGGTTAGTGCCACTATATATTGGGGCACCGGATATGGCGTTTCCCCGATTAAATAATATTAGTTTTTGGTTATTACCGCCTGCTTTGCTTTTATTGTTAGGTTCTGCTTTTGTTGAACAAGGTGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATTTATGCTCATTCTGGGGGTTCTGTTGATATGGCTATCTTTAGTCTTCATTTAGCTGGGGCTTCTTCTATCTTAGGAGCTATAAATTTTATTACAACGATTTTTAACATGCGAGCTCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTGCTTTTATCTTTGCCTGTATTGGCGGGTGCAATCACTATGTTGTTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGTGGAGATCCTATTTTATTCCAACATTTATTTTGGTTTTTTGGGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrogyra cylindrus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Moderately widespread distribution in the tropical western Atlantic but limited to shallower reef communities. Considered highly threatened due to greatly reduced recruitment rates and high susceptibility to sedimentation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4ce

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
This species is widespread and uncommon throughout its range. However, it is susceptible to bleaching, disease, and extensive reduction of coral reef habitat due to a combination of threats. It has low juvenile survivorship. Specific population trends are unknown but population reduction can be inferred from declines in habitat quality based on the combined estimates of both destroyed reefs and reefs at the critical stage of degradation within its range (Wilkinson 2004). Its threat susceptibility increases the likelihood of being lost within one generation in the future from reefs at a critical stage. Therefore, the estimated habitat degradation and loss of 38% over three generation lengths (30 years) is the best inference of population reduction and meets the threshold for Vulnerable under Criterion A4ce. It will be important to reassess this species in 10 years time because of predicted threats from climate change and ocean acidification.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Damaged by Hurricane Edith at Puerto Rico in 1963. Became absent from Panama a 1000 yrs ago.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is uncommon but conspicuous. Usually at low abundances, but can be locally abundant in shallower well-circulated areas due to propagation by fragmentation.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is particularly susceptible to bleaching, disease, and other threats and therefore population decline is based on both the percentage of destroyed reefs and critical reefs that are likely to be destroyed within 20 years (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Considered highly threatened due to high sensitivity to sedimentation, eutrophication and boat groundings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
This species is highly susceptible to disease (white plague), which has resulted in partial mortality to individual colonies (Bruckner and Bruckner 1997,Weil 2005). Localized impacts have been associated with hurricane damage (e.g., Rogers et al. 1991), other diseases, predation by damselfish, bioerosion by sponges. Collection for curios was reported to be a threat in the past (Colin, 1978), but this has now been banned (A. Bruckner pers. comm.).

Although it propagates through fragmentation, due to reproductive pattern (gonochoric), low juvenile survivorship, and the frequent occurrence of individual clones in localized areas this species may be slow to recover after disturbance events.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Data needed on colony growth as related to sedimentation and eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Few protected occurrences in the Florida Keys National Marine Sanctuary.

Needs: Extant populations should be included in marine protected areas with mooring buoys installed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., and Buck Island Reef National Monument. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. (Aronson, R., Precht, W., Moore, J., Weil, E., and Bruckner, A. pers. comm.)

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pillar coral

Pillar coral (Dendrogyra cylindricus) is a hard coral (order Scleractinia) found in the western Atlantic Ocean and the Caribbean Sea. It is a digitate coral -that is, it resembles fingers (Latin digites) or a cluster of cigars, growing up from the sea floor without any secondary branching. It is large and can grow on both flat and sloping surfaces at depths down to 20 m (65 ft). It is one of the few types of hard coral in which the polyps can commonly be seen feeding during the day.

Description[edit]

Pillar coral forms an encrusted base from which grow vertical cylindrical, round-ended columns. This coral can grow to a height of 3 m (10 ft) with pillars more than 10 cm (4 in) wide but is usually much smaller than this. The corallites from which the polyps protrude are smaller than 1 cm (0.4 in) in diameter and arranged in shallow meandering valleys with low ridges in between. The skeleton of the coral is not usually visible because the polyps are typically extended during the daytime, unlike most other coral species.[3] The mass of undulating tentacles gives the coral a furry appearance. This coral is usually some shade of beige or brown.[4]

Distribution and habitat[edit]

Close-up of polyps with tentacles extended

Pillar corals are found in the warmer parts of the western Atlantic Ocean and the Caribbean Sea. Within its range, D. cylindricus is common in some places, but rare in other seemingly suitable locations. Some of the islands in the Bahamas have plentiful numbers of colonies as does the north coast of Jamaica. It used to be common on the reefs off the coast of Florida but has suffered from over-collection there. It seems to be absent from Bermuda and the coasts of Panama and Colombia. It usually grows on level or slightly sloping parts of the reef at depths between 1 and 20 metres (3 ft 3 in and 65 ft 7 in).[3]

Biology[edit]

Pillar coral is a zooxanthellate species, with symbiotic dinoflagellate algae living within the tissues. In sunlight these undergo photosynthesis and most of the organic compounds they produce are transferred to their host, while they make use of the coral's nitrogenous wastes.[5] These algae give the coral its brownish colour and restrict it to living in shallow water into which the sunlight can penetrate.[3]

Pillar coral is a slow-growing, long-lived species. A number of columns grow up from a basal plate; if the whole colony is dislodged and topples over, new cylindrical pillars can grow vertically from the fallen coral. Some specimens have been found where this has happened more than once, and the history of the colony can be deduced from its shape. If a pillar gets detached and becomes lodged in a suitable position, it can continue to live, sending up new pillars from the base and other parts of the column.[3]

Each pillar coral clonal colony is either male or female. Sexual reproduction takes place with gametes being released into the water column where fertilisation takes place. The larvae that hatch out of the eggs are planktonic and drift with the currents before settling on the seabed to found new colonies.[5]

Status[edit]

The IUCN Red List of Threatened Species lists pillar coral as being "Vulnerable". This is because recruitment and survival rates of juveniles is low and this coral is particularly susceptible to both bleaching and white plague disease.[1] It is resistant to strong wave action but can be wrecked by hurricanes and tropical storms. However, broken fragments regenerate well. Some of the localities in which it is found are in marine parks and in these it should be safe from human disturbance.[1]

Gallery[edit]

References[edit]

  1. ^ a b c Aronson, R.; Bruckner, A.; Moore, J.; Precht, B.; Weil, E. (2008). "Dendrogyra cylindricus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2012-12-03. 
  2. ^ WoRMS (2012). "Dendrogyra cylindrus Ehrenberg, 1834". World Register of Marine Species. Retrieved 2012-11-28. 
  3. ^ a b c d Colin, Patrick L. (1978). Marine Invertebrates and Plants of the Living Reef. T.F.H. Publications. p. 270. ISBN 0-86622-875-6. 
  4. ^ "Pillar coral (Dendrogyra cylindrus)". Interactive Guide to Caribbean Diving. Marine Species Identification Portal. Retrieved 2012-11-28. 
  5. ^ a b "Pillar coral (Dendrogyra cylindrus)". ARKive. Retrieved 2012-11-28. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!