Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Veron, 2000 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Echeverr?et al., 1997 YES MINERAL ARAGONITE
Castro et al., 1995 YES MINERAL ARAGONITE
Pires et al., 1992 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the southern Caribbean, in Jamaica and the Cayman Islands, and on the north coast of South America from Colombia and Venezuela, and in Trinidad and Tobago. It is also known from Brazil, from Ceara to Cabo Frio, and the oceanic Ferbando de Noronha Archipelago, Trindade Island, and Atol das Rocas (Pires et al. 1992, Echeverria et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Moderately widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Jamaica, Mexico, Curacao, Bonaire and Brazil.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Type Information

Holotype for Porites branneri Rathbun, 1888
Catalog Number: USNM 10961
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Parahyba Do Norte, Paraiba, Brazil, South Atlantic Ocean
  • Holotype: Rathbun. 1888. Proc. U.S. Natl. Mus. 10: 355-356, pl.19, fig.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Porites branneri Rathbun, 1888
Catalog Number: USNM 10962
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Pernambuco, Brazil, South Atlantic Ocean
  • Paratype: Rathbun. 1888. Proc. U.S. Natl. Mus. 10: 355-356, pl.19, fig.2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in shallow-water (0-3 m) reef and hard-ground environments, channels, and intertidal pools, in areas with good water circulation. It may be common in Acropora palmata thickets in the southern Caribbean.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range from 0.1-12 m and is only known to occur on bank reef types.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0.5 - 55
  Temperature range (°C): 22.801 - 27.668
  Nitrate (umol/L): 0.212 - 1.684
  Salinity (PPS): 35.207 - 37.169
  Oxygen (ml/l): 4.518 - 4.993
  Phosphate (umol/l): 0.038 - 0.150
  Silicate (umol/l): 1.470 - 3.566

Graphical representation

Depth range (m): 0.5 - 55

Temperature range (°C): 22.801 - 27.668

Nitrate (umol/L): 0.212 - 1.684

Salinity (PPS): 35.207 - 37.169

Oxygen (ml/l): 4.518 - 4.993

Phosphate (umol/l): 0.038 - 0.150

Silicate (umol/l): 1.470 - 3.566
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

1 - 1000 individuals

Comments: Little habitat information from resources consulted but is known to occur on fringing reefs and spur and groove reefs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Little information on life history strategies from resources consulted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

No information on reproductive ecology from resources consulted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Porites branneri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACGTTATATTTAGTATTTGGGATTGGGGCAGGTATGCTCGGTACAGCCTTCAGTATGTTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGAC---GATCATCTTTATAATGTAATTGTTACAGCACACGCTTTTATTATGATCTTTTTTTTGGTTATGCCAGTAATGATAGGGGGATTTGGGAATTGGTTGGTTCCATTATATATTGGGGCGCCTGATATGGCTTTTCCACGGCTTAATAACATTAGTTTTTGGCTGTTACCCCCTGCTTTAATATTGTTATTAGGTTCTGCTTTTGTCGAACAAGGAGCGGGTACCGGATGAACGGTTTATCCTCCTCTATCTAGCATTCAGGCCCATTCTGGCGGGGCGGTGGATATGGCTATTTTTAGTCTCCACTTAGCTGGGGCGTCCTCGATTTTGGGTGCAATGAATTTTATAACAACTATATTTAATATGAGGGCCCCTGGGCTAACGTTGAATAGAATGCCCTTATTTGTGTGGTCAATCTTGATCACTGCTTTTTTATTATTATTGTCTTTGCCCGTATTAGCGGGGGCCATAACCATGCTTTTAACGGATAGAAACTTTAATACTACTTTCTTTGATCCCGCAGGGGGGGGAGATCCGATTTTATTTCAACATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Porites branneri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. However, this species is also highly susceptible to disease and a number of localized threats given that occurs in very shallow water. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is widespread in the Caribbean, and although uncommon throughout its range, it can survive in off-reef areas and has a low susceptibility to bleaching, and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 15% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category. However, since this population reduction estimate is close to a threatened threshold, and because this species is moderately susceptible to a number of threats, it is likely to be one of the species lost on some reefs currently at the critical stage of degradation and therefore is Near Threatened. Predicted threats from climate change and ocean acidification make it important to reassess this species in 10 years or sooner, particularly if the species is actually observed to disappear from reefs currently at the critical stage of reef degradation. If the form in the Caribbean is confirmed to represent a distinct taxon, it may fall into a threatened category and both species will require reassessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Moderately widespread distribution in the tropical western Atlantic but little information on abundance or habitat specificity. Little known concerning life history strategies or threats.

Other Considerations: Quantitative data on habitat specificity derived from information on other branching species in genus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is uncommon in shallow-water exposed environments.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Information is needed on the status and trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Typical threats for shallow-water corals (e.g., pollution, bleaching, sedimentation) may result in localized declines.

However, the genus is not particularly susceptible to bleaching, but is more prone to disease than many other corals. Coral disease has emerged as a serious threat to coral reefs worldwide and is a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the Great Barrier Reef were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification. In addition to global climate change, corals are also threatened by a number of localized threats. Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities. The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: No specific threats cited in resources consulted but may be similar to P. porites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further taxonomic work is needed to clarify the status and distribution of the form in the Caribbean.

All corals are listed on CITES Appendix II. Parts of this species distribution fall within several Marine Protected Areas within its range.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.

Having timely access to national-level trade data for CITES analysis reports would be valuable for monitoring trends this species. The species is targeted by collectors for the aquarium trade and fisheries management is required for the species, e.g., Marine Protected Areas, quotas, size limits, etc. Consideration of the suitability of species for aquaria should also be included as part of fisheries management, and population surveys should be carried out to monitor the effects of harvesting.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Data needed on colony growth, reproduction and recruitment. Information needed on susceptibility to disease, sedimentation and eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Populations in marine protected areas limited to Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys need to be installed proximate to populations. Occurrences should be included in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!