Overview

Brief Summary

Biology

The brown hydra, although largely a sessile species is capable of moving by gliding along on the 'basal disc', the part of the body that attaches to the substrate. They may also move by bending the body around, attaching to the substrate with the tentacles, and then 'somersaulting' or 'looping' forwards (3). This species is carnivorous; it feeds on small aquatic invertebrates that are paralysed by the stinging cells when the prey comes into contact with the tentacles. The prey item is then brought to the mouth by the tentacles and taken into the body of the hydra (3). Reproduction in hydras typically takes place asexually by a process known as 'budding', in which a bud-like growth on the body of the 'parent' hydra eventually grows into a new individual that becomes separated from the parent. When conditions are harsh, or there is a shortage of food, hydras can reproduce sexually; a single individual may produce both male and female sex cells, which are released into the water where fertilisation occurs. The egg develops into a larva, which is covered in tiny hair-like structures known as cilia. The larva may either settle immediately and develop into a hydra, or become surrounded in a tough outer layer that allows it to survive harsh conditions (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Hydras are freshwater animals that belong to the same group as jellyfish, corals and sea anemones (2). The sac-shaped 'body' is topped with a mouth surrounded by a crown of tentacles that feature stinging cells used to stun prey (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The brown hydra is commonly found in the Northern Hemisphere and parts of Australia.

Biogeographic Regions: nearctic (Native ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The brown hydra is a widespread species, found throughout the northern hemisphere and parts of Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Hydras are are well known as the faunas of ponds, spring brooks, unpolluted streams, rivers, and the littoral zone of lakes.

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This hydra is found in freshwater ponds, brooks, rivers, and streams as well as at the edges of lakes, and typically attaches to aquatic plants, stones, twigs and debris (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hydra oligactis, as in all Cnidaria, are strictly carnivorous and eat many different kinds of small metazoans, including annelids, copepods, cladocerans, and insects. Hydra capture their food by paralyzing and killing the food organism by means of nematocysts, which are discharged into the prey. The prey is brought to the mouth (proctostome) by the tentacles, a response that is induced glutathione. This is considered the key mechanism in digestion. The organism is then taken in through the mouth, which is star-shaped or circular. Hydras have been known to feed on the organic material of the substrate when the food supply is insufficient. This behavior, however, is not considered normal. Digestion is both extra and intracellular.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The common asexual method of reproduction by hydras is budding. Buds originate at the junction of the stalk and gastric regions. The bud begins as a hemispherical outpouching that eventually elongates, becomes cylindrical, and develops tentacles. The bud then pinches off and a new individual becomes independent. Buds are produced every two to three days under favorable conditions. Following unfavorable conditions, such as injuries or periods of scarce resources, hydras occasionally reproduce through transverse and longitudinal fission.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydra oligactis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCI949-08|EU237491|Hydra oligactis| ACACGTTGAATGTTTTCAACTAATCATAAAGATATAGGAACTTTATATATAGTTTTTGGAGCTTTTTCTGGTATGATAGGTACTGCTTTA---AGTATGTTAATTAGAATTGAACTTTCTGCACCTGGAAGAATAATTGGAGAC---GATCATTTATATAATGTAATAGTAACTGCTCATGCTTTTGTTATGATATTTTTTTTAGTAATGCCAGTTTTAATAGGAGGGTATGGTAACTGGTTTGTTCCTATT---TATATAGGAGCACCAGACATGGCCTTTCCTAGACTAAATAACTTAAGTTTTTGATTACTTCCCCCCGCATTAATTTTACTTTTAACTTCTTCTCTAGTAGAACAAGGAGCTGGTACTGGGTGAACTGTTTACCCCCCTTTATCTGGACCATTAGCTCATTCTGGGGGTTCTGTTGATTTA---GCTATTTTCAGTTTACACTGTGCCGGATTTTCTTCTATTGCAGGAGCAATAAATTTTATTACAACTGTATTTAATATGAGAACACCAGGATTAACATTTGACAAACTTCCCTTATTTGTATGATCAGTATTAATTACAGCATTTTTATTACTATTATCATTGCCTGTCTTAGCAGGA---GCAATAACTATGCTTTTAACTGATAGAAATTTTAACACTACTTTTTTTGATCCGGCCGGAGGAGGTGATCCTGTATTATACCAACATCTGTTTTGATTTTTTGGTCACCCTGAAGTTTACATTTTAATAATTCCAGGATTTGGAATAGTTTCACAAATCATTCCTATTTTTAGTTCAAAAAAT---CAAGTATTCGGCTATCTTGGAATGATCTACGCTCAATTGGCTATAGCTTTCCTAGGATTTATAGTATGAGCTCATCATATGTTTACAATAGGAATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hydra oligactis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread in Britain (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

This species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The brown hydra is not listed under any conservation legislation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Hydra oligactis is a hatchery nuisance because it may kill fish fry.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hydra oligactis

Hydra oligactis, also known as the brown hydra, is a species of hydra found widely dispersed in the northern temperate zone. It is a common organism found in still waters from early Spring to late Autumn.

It is commonly found attached to the stems of water plants, the undersides of leaves , submerged twigs and on the surface of stones. When disturbed it retracts to a small brown blob which is easily overlooked. Gently sweeping through a clean weedy pond and allowing the collected water and leaves to stand in a jar will often reveal Hydra emerging after only a few minutes.

When in feeding mode, the fully extended tentacles are very long and may exceed 1 inch (25 mm) in length. In this condition the tentacles are very difficult to see with the naked eye and are often only revealed when a prey animal such as Daphnia is caught. The relative length of the tentacles compared to the body is characteristic of the species and serves to differentiate it from any other brown Hydra of cool temperate waters.

References

  1. ^ Schuchert, P. (2011). "Hydra oligactis Pallas, 1766". In P. Schuchert. World Hydrozoa database. World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=290145. Retrieved 2011-12-20. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!