Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

pleustonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physalia physalis is also known as the Portuguese man-of-war. It is a siphonophore, an animal that is made up of a colony of organisms working together, with individual polyps specialized for movement, catching prey, feeding and breeding. The name comes from the uppermost polyp, a gas filled bladder, or pneumatophore, which sits above the water and somewhat looks like an old warship at full sail.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Physalia physalis also known as the Portuguese Man O' War is commonly mistaken for a jellyfish. "The Portuguese man-of-war is a siphonophore, an animal that is made up of a colony of organisms working together. The name comes from the uppermost polyp, a gas filled bladder, or pneumatophore, which sits above the water and somewhat looks like an old warship at full sail. They are also, known as bluebottles for the purple-blue color of their pneumatophores" (A Portuguese man of war). The tentacles can extend to 165 feet, although, the average length is 30 feet (Portuguese Man-of War Physalia physalis).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Description

 Each 'individual' Physalia physalis is composed of a group of polyps specialised for movement, catching prey, feeding and breeding. The individual polyps are dependent on each other for survival, each having a distinct role. A large, purple, gas filled float (the pheumatophore) reaching up to 30 cm in height allows Physalia physalis to float on the surface. The crest running along the top of the pheumatophore acts as a sail when raised. The jellyfish has many digestive polyps (gastrozooids), which hang down and secrete digestive juices onto the prey that has been caught and immobilised by the sting of the long, contractile tentacles (the dactylozooids). The tentacles may hang down several meters and have a bead-like appearance. Each 'bead' contains specialised stinging cells (nematocysts), which produces a debilitating sting.Even though individual Physalia physalis are not an unusual sight on the coasts of Britain and Ireland, mass standings are uncommon, occurring only 3 or 4 times a century (Wilson, 1947). The sting of Physalia physalis causes severe pain, skin lacerations, convulsions, respiratory distress and in some cases death (Williamson et al., 1996). The sting remains potent even after death and the tentacles should not be touched. Portuguese man owar are carnivorous feeding mainly on small crustaceans and larval fish (Kirkpatrick & Pugh, 1984).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic Europe, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Boulogne-sur-Mer, Bretagne, Canadian Exclusive Economic Zone [Pacific part], Cobscook Bay, Dunkerque, European waters (ERMS scope), FAO fishing area 67, Gulf of Maine, Gulf of Mexico, Mediterranean Sea, New Zealand Exclusive Economic Zone, North East Atlantic, North East Pacific, North Pacific, North West Atlantic, Plymouth, United Kingdom Exclusive Economic Zone, Villefranche-Sur-Mer, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

This species has been found in the Atlantic Ocean, the Pacific Ocean, the Indian Ocean, the Caribbean, and the Sargasso Sea. It floats on or near the surface of the water.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tropical Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

mainly (sub)tropical
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay of Fundy; Virginian, south side of Cape Cod, and extending northward of the subprovince limit.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Physalia physalis is found in tropical Atlantic waters and occasionally as far north as the Bay of Fundy and the Hebrides, and the Mediterranean Sea Portuguese Man o' war). They are reported abundantly off the Karachi coast in Pakistan, and are also common in the ocean off parts of Australia and New Zealand, particularly at the Sandspit and Hawkes Bay beaches during the months of June, July, and August. They are known to come ashore all along the northern Gulf of Mexico and both east and west coasts of Florida as well as around the Hawaiian Islands "(Portuguese Man o' war).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Portuguese man-of-war is a floating hydrozoan. It is actually a colony consisting of four types of polyps: a pneumatophore, or float; dactylozooids, or tentacles; gastrozooids, or feeding zooids; and gonozooids which produce gametes for reproduction. Cnidocytes (stinging cells) are located in the tentacles. Their action is based on their individual osmotic and hydrostatic pressure. Sensory cells are numerous and are located in the epidermis of the tentacles and the region around the mouths. Generally, the sensory cells are receptors for touch and temperature.

The stinging cells, or cnidocytes, are the characteristic food-getting mechanisms of jellyfish and their close relatives. P. physalis has two sizes of cnidocytes, some small and others are large. These cells retain their potency long after an individual has been washed up along the shore, as many hikers along beaches have discovered to their dismay and discomfort.

Other Physical Features: ectothermic ; heterothermic ; venomous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Float to 15 cm, with crest; many long tentacles hang beneath. Habitat: floating at surface, occasionally inshore. Distribution: pantropical and warm-temperate. Sting severe, but rarely lethal. Specimens with a single main tentacle are thought by some to be a distinct species (Richmond, 1997).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

The Portuguese man-of-war floats on the surface of tropical, marine waters. Generally, these colonies live in warm tropical and subtropical water such as along the Florida Keys and Atlantic coast, the Gulf Stream, the Gulf of Mexico, the Indian Ocean, the Caribbean Sea, and other warm areas of the Atlantic and Pacific oceans. They are especially common in the warm waters of the Sargasso Sea.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

pelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 17 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0 - 4976
  Temperature range (°C): -1.043 - 9.846
  Nitrate (umol/L): 18.472 - 31.346
  Salinity (PPS): 34.559 - 35.236
  Oxygen (ml/l): 3.475 - 6.713
  Phosphate (umol/l): 1.228 - 2.369
  Silicate (umol/l): 13.311 - 87.548

Graphical representation

Depth range (m): 0 - 4976

Temperature range (°C): -1.043 - 9.846

Nitrate (umol/L): 18.472 - 31.346

Salinity (PPS): 34.559 - 35.236

Oxygen (ml/l): 3.475 - 6.713

Phosphate (umol/l): 1.228 - 2.369

Silicate (umol/l): 13.311 - 87.548
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 A pelagic warm water species driven into to shore by winds and currents.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Men-of-war are most often found in warm, tropical and subtropical waters of the world’s oceans "(Portuguese Man-of-war Physalia physalis).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Portuguese Man-of-War traps its food in its tentacles. It feeds mainly on fish fry (young fish) and small adult fish, and it also consumes shrimp, other crustaceans, and other small animals in the plankton. Nearly 70 to 90% of the prey are fish.

The tentacles, or dactylozooids, are the Man-of-War's main mechanisms for catching its prey and are also used for defense. P. physalis sometimes traps and consumes larger fishes such as flying fish and mackerel, though fishes as large as these generally manage to escape from the tentacles. The food of the Man-of-War is digested in its bag-like stomachs (gastrozooids), which are located along the underside of the float. The gastrozooids digest the prey by secreting enzymes that break down proteins, carbohydrates and fats. Each Man-of-War has multiple gastrozooids complete with individual mouths. After the food has been digested, any undigestible remains are pushed out through the mouths. The nourishment from the digested food is absorbed into the body and eventually circulates to the different polyps in the colony.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"They feed on prey including fish, fish larvae, cephalopods, chaetognaths, and leptocephalus (eel) larvae. Their tentacles have pigmented regions that resemble larval fish, small shrimp, and copepods to lure prey into their stinging net" (Hoover). Their tentacles tangle and stun their prey. After the prey is trapped, Physalia physalis contracts its tentacles to bring the prey into contact with polyps that secrete digestive enzymes to soften their catch (Hoover).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

An "individual" is actually a colony of unisexual organisms. Every individual has specific gonozooids (sex organs or reproductive parts of the animals, either male or female). Each gonozooid is comprised of gonophores, which are little more than sacs containing either ovaries or testes.

Physalia are dioecious. Their larvae probably develop very rapidly to small floating forms.

Fertilization of P. physalis is assumed to occur in the open water, because gametes from the gonozooids are shed into the water. This may happen as gonozooids themselves are broken off and released from the colony. The release of gonozooids may be a chemical response occurring when groups of individuals are present in one locality. Critical density is probably required for successful fertilization. Fertilization may take place close to the surface. Most reproduction takes place in the fall, producing the great abundance of young seen during the winter and spring. It is not known what triggers this spawning cycle but it probably begins in the Atlantic Ocean.

Germ Cell Development

Each gonophore has a central spadix of multinucleate endodermal cells separating the coelenteron from a layer of germ cells. Covering each germ cell is a layer of ectodermal tissue. When gonophores first bud, the germ layer is a cap of cells on top of the endodermal spadix. As gonophores mature, the germ cells develop into a layer covering the spadix. Spermatogonia form a thick layer, while oogonia form a convoluted band several cells wide, but only one cell layer thick. There is very little cytoplasmic material within these cells, except during rare instances when cell division is occurring. Oogonia begin development at approximately the same size as spermatogonia, but become considerably larger. All oogonia are apparently formed at an early stage of gonophore development prior to the occurrence of enlargement. Interestingly, there appears to be yolk globules within the cytoplasm of most oogonia.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Physalia physalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATACCTAGTCTTTGGTTTATTTTCGGGTATGGTAGGGACTGCTCTTAGTATGTTAATCAGATTGGAGTTATCAGGGCCCGGTACTATGTTTGGGGAC---GATCACCTTTATAATGTTATAGTAACTGCTCATGCTTTTGTCATGATCTTCTTCCTTGTAATGCCAGTCCTAATCGGGGGTTTCGGTAACTGATTTGTACCTTTGTTTATAGGTGCTCCGGATATGGCCTTCCCTAGGTTAAACAACCTAAGTTTTTGATTATTGCCACCTGCTTTGCTATTATTACTAGGGTCATCCCTAATAGAGCAAGGTGCAGGAACTGGTTGAACTGTTTATCCTCCTTTATCTGGCCCCCAAACCCATTCTGGGGGATCAGTTGATATGGCCATTTTCAGTTTACACTGTGCGGGTGCCTCCTCAATTATGGGTGCTATTAACTTCATAACCACTATATTTAATATGAGGGCCCCTGGTATGACTATGGATAAACTACCACTGTTTGTTTGGTCAGTTTTAATAACTGCTTTCCTTTTACTACTATCATTACCAGTATTGGCCGGTGCCATAACTATGTTACTTACTGATAGGAATTTTAATACTACTTTCTTCGACCCCGCAGGAGGTGGTGACCCAGTTCTCTATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Physalia physalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Physalia physalis is not especially rare, and not considered to need special conservation effort at this time.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species can hurt tourists and tourism in areas where it is common, due to stings (of neurotoxins) from its cnidocytes. Much money is spent each year to treat swimmers who have been stung by the tentacles of individuals that have washed up on beaches. The inflammatory response resulting from stings is due to the release of histamines from mast cells within the victim.

Negative Impacts: injures humans (bites or stings, venomous )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The Portuguese Man-of-War is eaten by some fish and crustaceans (e.g. the sand crab) that can be of commercial value.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Portuguese man o' war

The Portuguese man o' war (Physalia physalis), also known as the Portuguese man-of-war, Man-Of-War, or bluebottle, is a jellyfish-like marine cnidarian of the family Physaliidae. Its venomous tentacles can deliver a powerful sting.

Despite its outward appearance, the man o' war is not a jellyfish but a siphonophore, which differs from jellyfish in that it is not actually a single organism, but a colonial organism made up of many minute individuals called zooids.[1] Each of these zooids is highly specialized, and, although structurally similar to other solitary animals, they are attached to one another and physiologically integrated to the extent that they are incapable of independent survival.

Contents

Etymology [edit]

The name "man o' war" comes from the man-of-war, an 18th-century armed sailing ship,[2] and the cnidarian's supposed resemblance to the Portuguese version at full sail.[3] (In other languages it is simply known as the 'Portuguese war-ship' (Dutch: Portugees Oorlogsschip), the 'Portuguese Galley' (German: Portugiesische Galeere, Hungarian: portugál gálya), or the 'Portuguese Caravel' (Portuguese: "Caravela Portuguesa").

Habitat and location [edit]

The Portuguese man o' war lives at the surface of the ocean. The gas-filled bladder, or pneumatophore, remains at the surface, while the remainder is submerged.[4] Since the man o' war has no means of propulsion, it is moved by a combination of winds, currents, and tides. Although it can be found anywhere in the open ocean (especially warm water seas), it is most commonly found in the tropical and subtropical regions of the Pacific and Indian oceans and in the northern Atlantic Gulf Stream. The man o' war has been found as far north as the Bay of Fundy and the Hebrides.[5]

Strong winds may drive them into bays or onto beaches. It is rare for only a single Portuguese man o' war to be found; often the finding of one results in the finding of many.[4] Attitudes to the presence of the Portuguese man o' war vary around the world. Given their sting, however, they must always be treated with caution, and the discovery of men o' war washed up on a beach may lead to the closure of the whole beach.[6]

Structure [edit]

Physalia physalis

The Portuguese man o' war is composed of four types of polyp.[4] One of the polyps, a gas-filled bladder called the pneumatophore (commonly known as the sail), enables the organism to float. This sail is bilaterally symmetrical, with the tentacles at one end, and is translucent, tinged blue, purple, pink, or mauve. It may be 9 to 30 centimetres (3.5 to 12 in) long and may extend as much as 15 centimetres (5.9 in) above the water. The Portuguese man o' war generates carbon monoxide in its gas gland, filling its gas bladder with up to 13% carbon monoxide. The remainder is nitrogen, oxygen and argon, atmospheric gases that diffuse into the gas bladder. Carbon dioxide occurs at trace levels.[7] The sail is equipped with a siphon. In the event of a surface attack, the sail can be deflated, allowing the man o' war to briefly submerge.[8]

The other three polyp types are known as dactylozooid (defence), gonozooid (reproduction), and gastrozooid (feeding).[9] These polyps are clustered. The dactylzooids make up the tentacles that are typically 10 metres (33 ft) in length but can be up to 50 metres (160 ft).[4] The long tentacles "fish" continuously through the water, and each tentacle bears stinging, venom-filled nematocysts (coiled, thread-like structures), which sting and kill small sea organisms such as small fish and shrimp. Contractile cells in each tentacle drag the prey into range of the digestive polyps, the gastrozooids, which surround and digest the food by secreting enzymes that break down proteins, carbohydrates and fats. Gonozooids are responsible for reproduction.

Venom [edit]

This species and the smaller Indo-Pacific man o' war are responsible for up to 10,000 human stings in Australia each summer, particularly on the east coast, with some others occurring off the coast of South Australia and Western Australia.[10]

The stinging, venom-filled nematocysts[11] in the tentacles of the Portuguese man o' war can paralyze small fish and other prey. Detached tentacles and dead specimens (including those that wash up on shore) can sting just as painfully as the live organism in the water and may remain potent for hours or even days after the death of the organism or the detachment of the tentacle.[12]

Stings usually cause severe pain to humans, leaving whip-like, red welts on the skin that normally last 2 or 3 days after the initial sting, though the pain should subside after about an hour. However, the venom can travel to the lymph nodes and may cause, depending on the amount of venom, a more intense pain.[citation needed] A sting may lead to an allergic reaction. There can also be serious effects, including fever, shock, and interference with heart and lung function. Stings may also cause death,[13] although this is extremely rare. Medical attention may be necessary, especially if pain persists or is intense, there is an extreme reaction, the rash worsens, a feeling of overall illness develops, a red streak develops between swollen lymph nodes and the sting, or either area becomes red, warm and tender.

Treatment of stings [edit]

The best treatment for a Portuguese man o' war sting is:

  • To avoid any further contact with the Portuguese man o' war and to carefully remove any remnants of the organism from the skin (taking care not to touch them directly with fingers or any other part of the skin to avoid secondary stinging); then
  • To apply salt water to the affected area (not fresh water, which tends to make the affected area worse)[14][15]
  • To follow up with the application of hot water (45 °C/113 °F) to the affected area from anywhere between 15-20 minutes [16] which eases the pain of a sting by denaturing the toxins.[17]
  • If eyes have been affected, to irrigate with copious amounts of room-temperature tap water for at least 15 minutes, and if vision blurs or the eyes continue to tear, hurt, swell, or show light sensitivity after irrigating, or there is any concern, to see a doctor as soon as possible.

Vinegar is not recommended for treating stings.[15] Vinegar dousing increases toxin delivery and worsens symptoms of stings from the nematocysts of this species. Vinegar has also been confirmed to provoke hemorrhaging when used on the less severe stings of nematocysts of smaller species.[18]

The Portuguese man o' war is often confused with jellyfish by its victims, which may lead to improper treatment of stings, as the venom differs from that of true jellyfish.

Predators and prey [edit]

The Portuguese man o war is a carnivore.[4] Using its venomous tentacles, a man o' war traps and paralyzes its prey. Typically, men o' war feed upon small aquatic organisms, such as fish and plankton.

Portuguese man o' war in Tayrona national park, Colombia

The loggerhead turtle feeds on the Portuguese man o' war, a common part of the loggerhead's diet.[19] The turtle's skin is too thick for the sting to penetrate.

The sea slug Glaucus atlanticus also feeds on the Portuguese man o' war,[20] as does the violet snail Janthina janthina.[21]

The blanket octopus is immune to the venom of the Portuguese man o' war; young individuals carry broken man o' war tentacles, presumably for offensive and/or defensive purposes.[22]

The ocean sunfish's primary diet consists of jellyfish, but it can also consume Portuguese men o' war.

Commensalism and symbiosis [edit]

A small fish, Nomeus gronovii (the man o' war fish or shepherd fish), is partially immune to the poison from the stinging cells and can live among the tentacles. It seems to avoid the larger, stinging tentacles, but feeds on the smaller tentacles beneath the gas bladder. The Portuguese man o' war is often found with a variety of other marine fish, including clownfish and yellow jack. The clownfish can swim among the tentacles with impunity, possibly owing to their mucus, which does not trigger the nematocysts.

All of these fish benefit from the shelter from predators provided by the stinging tentacles, and for the Portuguese man o' war the presence of these species may attract other fish to feed on.[23]

Gallery [edit]

Portuguese men o' war washed ashore on Maroubra Beach, New South Wales, Australia 
Portuguese man o' war captured live in Mayaro Beach, Trinidad and Tobago 

See also [edit]

References [edit]

  1. ^ Grzimek, B., N. Schlager & D. Olendorf 2003. Grzimek's Animal Life Encyclopaedia. Thomson Gale.
  2. ^ Marine Science Textbook by Thomas F. Greene
  3. ^ David Millward (8 September 2012). "Surge in number of men o'war being washed up on beaches". The Daily Telegraph. Retrieved 8 September 2012. 
  4. ^ a b c d e Portuguese Man-of-War. National Geographic.
  5. ^ Halstead,B.W., Poisonous and Venomous Marine Animals of the World, 1988, Darwin Press
  6. ^ "Dangerous jellyfish wash up". BBC News. 2008-08-18. Retrieved 2011-09-07. /
  7. ^ Wittenberg, Jonathan B. (1960-01-12). "The Source of Carbon Monoxide in the Float of the Portuguese Man-of-War, Physalia Physalis L". Journal of Experimental Biology 37 (4): 698–705. ISSN 1477-9145 0022-0949, 1477-9145. Retrieved 2013-02-12. 
  8. ^ Physalia physalis. "Portuguese Man-of-War Printable Page from National Geographic Animals". Animals.nationalgeographic.com. Retrieved 2009-12-07. 
  9. ^ "Aloha.com". Aloha.com. Retrieved 2011-09-08. 
  10. ^ Fenner, Peter J.; John A. Williamson (December 1996). "Worldwide deaths and severe envenomation from jellyfish stings". Medical Journal of Australia 165 (11–12): 658–661. ISSN 0025-729X. PMID 8985452. Retrieved 2009-09-04. "In Australia, particularly on the east coast, up to 10 000 stings occur each summer from the bluebottle (Physalia spp.) alone, with others also from the "hair jellyfish" (Cyanea) and "blubber" (Catostylus). More bluebottle stings occur in South Australia and Western Australia, as well as stings from a single-tentacled box jellyfish, the "jimble" (Carybdea rastoni)" 
  11. ^ 5. Yanagihara, A.A., Kuroiwa, J.M.Y., Oliver, L., and Kunkel, D.D. The ultrastructure of nematocysts from the fishing tentacle of the Hawaiian bluebottle, Physalia utriculus (Cnidaria, Hydrozoa, Siphonophora). Hydrobiologia 489, 139–150, 2002.
  12. ^ Auerbach, PS. (1997). "Envenomation from jellyfish and related species". J Emerg Nurs 23 (6): 555–565. doi:10.1016/S0099-1767(97)90269-5. PMID 9460392. 
  13. ^ Stein MR, Marraccini JV, Rothschild NE, Burnett JW. (1989). "Fatal Portuguese man-o'-war (Physalia physalis) envenomation". Ann Emerg Med 18 (3): 312–315. doi:10.1016/S0196-0644(89)80421-4. PMID 2564268. 
  14. ^ specialist from the University of Southampton appearing on BBC Breakfast program, date: 8am, Tue 19 August 2008.
  15. ^ a b Slaughter RJ, Beasley DM, Lambie BS, Schep LJ (2009). "New Zealand's venomous creatures". N. Z. Med. J. 122 (1290): 83–97. PMID 19319171. 
  16. ^ 3. Yoshimoto, C.M., and Yanagihara, A.A. Cnidarian (coelenterate) envenomations in Hawai’i improve following heat application. Transactions of the Royal Society for Tropical Medicine and Hygiene 96, 300–303, 2002.
  17. ^ Loten C, Stokes B, Worsley D, Seymour J, Jiang S, Isbistergk G (2006). "A randomised controlled trial of hot water (45 °C) immersion versus ice packs for pain relief in bluebottle stings". Med J Aust 184 (7): 329–333. PMID 16584366. 
  18. ^ Exton DR (1988). "Treatment of Physalia physalis envenomation". Med J Aust 149 (1): 54. PMID 2898725. 
  19. ^ Brodie: Venomous Animals, Western Publishing Company 1989
  20. ^ By Carla Scocchi and Dr. James B. Wood site. "Glaucus atlanticus, Blue Ocean Slug". Thecephalopodpage.org. Retrieved 2009-12-07. 
  21. ^ Morrison, Sue; Storrie, Ann (1999). Wonders of Western Waters: The Marine Life of South-Western Australia. CALM. p. 68. ISBN 0-7309-6894-4. 
  22. ^ "Tremoctopus". Tolweb.org. Retrieved 2009-12-07. 
  23. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!