Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Living Material

The abundance of these animals varies from year to year; adults have been captured at all times of the year, but are not found near the surface during stormy weather.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lion's mane jellyfish are not often found in the North Sea. The jellyfish can sting badly with its long hairy tentacles located on the rim of the bell. These tentacles can grow up to several meters long! Those animals that are not sensitive to the poison prefer to live close by the jellyfish. The toxin scares away enemies, making it a safe place for others. Reddish specimen of blue jellyfish are sometimes mistaken for lion's mane jellyfish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 Cyanea capillata is one of the largest species of jellyfish and is commonly referred to as Lions mane jellyfish due to the highly distinguishable mass of long, thin, hair-like tentacles. Cyanea capillata has a saucer-shaped bell (the umbrella) with a uniform thickness until thinning dramatically around the edges. Usually yellowish brown or reddish in colour. It generally grows to 30-50 cm in diameter in British waters. However, they have been know to grow up to 200 cm. The margin of the bell bears hollow tentacles, arranged in eight groups with 70 to 150 or more tentacles in each. The mouth and oral arms stem from a projection on the underside of the umbrella (the manubrium). The oral arms are thick, frilled, folded and generally as long as the diameter of the umbrella.Young Cyanea capillata may be found as early as February in British waters, although the main period of abundance for larger individuals is June to September. This species does occasionally occur in large swarms, largely thought to be due to storms and tides that concentrate individuals together (Russell, 1970). They have a very severe sting that can produce blisters, irritation, and muscular cramp and may even affect respiratory and heart function. Cyanea capillata can still sting long after being stranded on the shore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology/Natural History: Probably lives less than one year. This species can give a painful sting with blisters that lasts for several hours. It is the most likely jellyfish in our area to sting you, and may even trigger allergic shock. Feeds on small fish and crustaceans. Several symbionts may be found on the bell, including juvenile pollock and other fish, and decapod megalops larvae. The gonads of this species are 4 highly folded, ribbonlike structures that hang down under the bell and alternate with the 4 oral lobes. This is the world's largest jellyfish.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

This Scyphomedusa has a saucer-shaped bell up to 2 m in diameter at high latitudes; more southern specimens such as those near Rosario are usually closer to 50 cm. The bell has a thick center and a thinner margin. The margin is divided into 8 pairs of thick lobes (for a total of 16 lobes) (photo). Has 8 clusters of up to 150 highly extensible tentacles arranged in several rows, arising from horseshoe shaped regions between the lobes (photo). Has 8 rhopalia, each of which is situated between the two lobes of a pair (photo). Oral arms highly folded, forming a blocky mass only about as long as the bell is wide (but see this photo for extended oral arms). Color deep brick red to purplish, rose, violet, or even milky white. Yellowish-brown in small specimens, often more red in large individuals. The swimming medusa looks like an 8 pointed star at the end of its power stroke. The tentacles may trail down as far as 9 m in large specimens, 2 m in the 50 cm individuals found in our area.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Coloration bright and varied, most often of red or yellow tint.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

The lion's mane jellyfish is one of the largest species of jellyfish. One specimen that was found was 2.3 m in diameter and its tentacles were 36.5 m in length (Lion's mane jellyfish). There are as many as 150 long tentacles that are present beneath each of the eight lobes (Lion's mane jellyfish- Cyanea capillata).

  • Color- vivid yellow, orange, and sometimes appears to be a red color.
  • Size- can reach to be a diameter of 2 meters (Lion's Mane Jellyfish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Cosmopolitan species.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Florida
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

semi-cosmopolitan
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyanea capillata can be found in the cooler regions of the Atlantic, Pacific, North Sea and Baltic. They are especially prevalent near the east coast of Britain. (Grzimek 1972, Nichols 1979)

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cold-water species

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Arctic and north boreal. In the Pacific it is common as far south as Washington, occasionally seen in Oregon, and probably not as far south as California. In the Atlantic it can be found as far south as Florida and Mexico.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic, northern European, North American Atlantic and Pacific, southern Australian, and waters (Lion's mane jellyfish- Cyanea capillata).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Jellyfish are composed of 94% water and are radially symmetrical. It is dibloblastic, which means that it has two tissue layers. This member of the giant jellyfish has a hemispherical bell with scalloped edges. The bell is divided into eight obvious lobes by eight indentations with second order indentations. Some lobes contain sense organs including odor pits, balance organs, and simple light receptors. Its bell normally ranges in diameter from 30 to 80 cm, with some individuals growing up to a maximum of 180 cm. The oral arms are purple with reddish or yellow tentacles, hence the common name "Lion's Mane". The bell may be pink to reddish-gold or brownish-violet. The jellyfish has no fringing tentacles around the edge of its bell, but it has eight groups of 150 tentacles each on the underside of its umbrella. These tentacles contain very effective nematocysts, as does the upper surface of the jellyfish. (Banister and Campbell 1985, Grzimek 1972, Nichols 1979, Stachowitsch 1992)

Other Physical Features: ectothermic ; radial symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The edge of the umbrella carries 16 large lobes and 8 rhopalia. Feeding tentacles have numerous folds. 8 groups of long tentacles originate from the subumbrella surface near the edge of the umbrella. Radial and circular musculature very well developed.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

One of the largest scyphomedusae, diameter of the umbrella may reach 2 m, the length of the tentacles 20-30 m.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Phacellophora camtschatica also has 16 large marginal lobes, but they are not in pairs and between these are 16 smaller lobes resembling fish tails on which the rhopalia are found. The tentacles are in 16 linear groups (not 8) of up to 25 tentacles per group, hanging from the subumbrella. It is usually a lighter yellow color than is Cyanea capillata.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

coastal
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

upper epipelagic
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Lion's Mane Jellyfish is found in the cooler regions of the Atlantic, Pacific, North Sea, and Baltic Sea. They are especially common along the East coast of Britain. They are found in the pelagic zone as medusae and then benthic zone as polyps. (Grzimek 1972, Nichols 1979)

Aquatic Biomes: benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 150 specimens in 3 taxa.
Water temperature and chemistry ranges based on 75 samples.

Environmental ranges
  Depth range (m): 0 - 4791
  Temperature range (°C): -0.841 - 23.799
  Nitrate (umol/L): 0.325 - 19.534
  Salinity (PPS): 29.937 - 36.096
  Oxygen (ml/l): 4.714 - 8.874
  Phosphate (umol/l): 0.110 - 1.909
  Silicate (umol/l): 0.756 - 44.762

Graphical representation

Depth range (m): 0 - 4791

Temperature range (°C): -0.841 - 23.799

Nitrate (umol/L): 0.325 - 19.534

Salinity (PPS): 29.937 - 36.096

Oxygen (ml/l): 4.714 - 8.874

Phosphate (umol/l): 0.110 - 1.909

Silicate (umol/l): 0.756 - 44.762
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Cyanea capillata is pelagic species that can be found washed up on beaches.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Pelagic

Habitat: Pelagic near surface, in polar and temperate coastal waters.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This type of jellyfish is a coldwater species, it cannot cope in warm water (Lion's mane jellyfish). The medusae prefer cool temperatures below 70 degrees.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cyanea capillata feeds mainly on fish. It catches its prey by sinking slowly with its tentacles spread in a circle around it. The prey is captured in the "net" of tentacles and stunned by the nematocysts. (Grzimek 1972)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on zooplankton, small fish, ctenophores, and moon jellies (Lion's mane jellyfish). Their long tentacles capture large prey and bring them into their oral arms, where they are then enveloped and digested (Lion's mane jellyfish- Cyanea capillata).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Small fish larvae often find shelter beneath the umbrella.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Later Development

The free-swimming planulae are orange-red in color, well ciliated and opaque. The anterior end is distinctly broader than the posterior end, and the old blastopore, which develops into the mouth, may be visible. After a free-swimming life of from 20 to 40 days, the larva settles down and attaches by the narrow end to the substrate. There is an elongation of the body, followed by the acquisition of tentacles about the gaping mouth. The larva is now in the scyphula or scyphistoma stage. The number of tentacles increases from two to twenty-four. Agassiz (1862) gives diagrams of the planulae and young scyphulae. Apparently, stolonization and colony formation occasionally occur; strobilization is inconspicuous, and often only one strobilus is given off at a time, although occasionally three to five are released. Ephyrae can be produced 20 days after attachment, but normally this process takes 30 to 40 days.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Early Stages of Development

Maturation probably occurs in the gonad. The mature eggs, each with the second polar body clinging to the delicate egg membrane, then dehisce into the gastric pouches where fertilization occurs; the eggs lodge in folds of the oral lips, where they continue to develop until the planula stage. Cleavage is total, and may or may not be equal; often it is slightly irregular. A cleavage cavity appears early and a hollow, single-layered blastula is formed. Gastrulation is by invagination, although at times this may be accompanied by delamination. The spherical gastrula soon becomes oval and elongates into an active planula (1910) for details of early development; Okada (1927) describes the details of gastrulation.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"They possess a benthic polyp stage (larva) which reproduces asexually to give rise to ephyrae; these grow into dioecious, planktonic medusae (adults) that produce planulae (motile stereogastrulae), and the latter settle to the benthos to form polyps, completing the cycle "(Brewer).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding Season

Usually in March and early May, but some animals in the breeding condition can be taken as late as July.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The medusa form of the jellyfish reproduces sexually and has separate sexes. The ova and sperm are produced in baglike projections of the stomach wall. The sex cells are relased through the mouth for external fertilization. In the case of Cyanea, the eggs are held in the oral tentacles until the planula larvae develop. The planula larvae then settle on the substrate and develop into polyps. These scyphopolyps reproduce asexually by horizontal division (strobilation) and are then termed strobila. With each division, a small disk forms, and when multiple disks have formed, the uppermost one detaches and swims off as a ephyra. The ephyra develops into the recognized medusa form of the jellyfish. (Grzimek 1972)

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyanea capillata can sexually reproduce during the medusa stage and can asexually reproduce during the polyp stage (Lion's mane jellyfish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© LaPenna, Tara

Source: EOL Interns LifeDesk

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyanea capillata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTAATATTTGGTGCTTTTTCAGCCATGATTGGTACAGCTTTTAGTATGATAATAAGATTAGAGCTCTCAGGCCCAGGGTCTATGCTCGGAGAC---GACCAAATATATAATGTTATAGTAACAGCTCATGCTCTTGTTATGATATTCTTTTTTGTGATGCCCGTGTTGATTGGGGGTTTCGGAAATTGATTTGTCCCACTATATATTGGAAGTCCAGATATGGCTTTCCCTAGACTTAATAACATTAGTTTTTGATTATTACCTCCAGCCCTTCTATTATTATTAGGGTCTTCCTTAATTGAACAAGGAGCTGGAACAGGTTGGACTATTTATCCTCCTCTATCTTCCATACAATTTCATTCTGGGGGATCAGTAGATATGGCTATATTTAGTTTACATTTAGCTGGTGCTTCCTCTATAATGGGAGCCATAAATTTTATAACAACAATTTTTAACATGAGGGCCCCGGGTATGTCAATGGATAGGTTGCCTCTATTTGTATGGTCAGTACTGGTAACAGCCATTCTTTTACTATTATCCTTACCTGTGTTAGCTGGGGCAATTACAATGTTATTAACAGACAGGAATTTTAACACCTCTTTTTTCGACCCCGCAGGCGGAGGAGACCCAATCTTGTTTCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanea capillata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Cyanea capillata is in no danger of extinction.

US Federal List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Methods of Observation

If active planulae are placed in clean Syracuse dishes of sea water, they will attach and metamorphose. If the watch glasses with the attached scyphistomae are removed to aquaria and the larvae fed echinoderm larvae, copepods, etc., they will live for several months.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Obtaining Embryos

Mature animals can be recognized by the white or cream-colored gonads lining the gastric pockets. Eggs and developing larvae are found in the brood-pouches along the oral lobes; they appear as greyish specks to the unaided eye, and can be dissected out into a drop of sea water on a slide, for examination. The early cleavage stages and blastulae are found in the region of the mouth.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Care of Adults

No information is available.

  • Agassiz, L., 1862. Contributions to the Natural History of the United States of America. Vols. 3 and 4. Little, Brown and Co., Boston.
  • Hargitt, C. W., and G. T. Hargitt, 1910. Studies in tile development of Scyphomedusae. J. Morph., 21: 217-262.
  • Mcmurrich, J. P., 1891. The development of Cyanea arctica. Amer. Nat. 25: 287-289.
  • Okada, Y. K., 1927. Sur l'origine de l'endoderme des discomeduses. Buli. Biol. France et Belg., 61: 250-262.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Donald P. Costello and Catherine Henley

Source: Datasets

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lion's mane jellyfish

Lion's mane jellyfish!<-- This template has to be "warmed up" before it can be used, for some reason -->

The lion's mane jellyfish (Cyanea capillata) is the largest known species of jellyfish. Its range is confined to cold, boreal waters of the Arctic, northern Atlantic, and northern Pacific Oceans, seldom found farther south than 42°N latitude. Similar jellyfish, which may be the same species, are known to inhabit seas near Australia and New Zealand. The largest recorded specimen found, washed up on the shore of Massachusetts Bay in 1870, had a bell (body) with a diameter of 2.3 m (7 feet 6 inches) and tentacles 36.5 m (120 feet) long.[1][2][3]

Contents

Taxonomy

Cyanea sp.

The taxonomy of Cyanea species is not fully agreed; some zoologists have suggested that all species within the genus should be treated as one. Two distinct taxa, however, occur together in at least the eastern North Atlantic, with the blue jellyfish (Cyanea lamarckii Péron & Lesueur, 1810) differing in blue (not red) color and smaller size (10–20 cm diameter, rarely 35 cm). Populations in the western Pacific around Japan are sometimes distinguished as Cyanea nozakii Kisinouye, 1891, or as a race, Cyanea capillata nozakii.

Sting

Most encounters cause temporary pain and localized redness.[4] In normal circumstances, and in healthy individuals, their stings are not known to be fatal.

Description

Although capable of attaining a bell diameter of 2.5 m (8 feet), these jellyfish can greatly vary in size, those found in lower latitudes are much smaller than their far northern counterparts with bells about 50 cm (20 inches) in diameter. The tentacles of larger specimens may trail as long as 30 m (90 feet) or more. These extremely sticky tentacles are grouped into eight clusters, each cluster containing over 100 tentacles,[5] arranged in a series of rows.

At 120 feet in length, the largest known specimen was longer than a Blue Whale and is generally considered the longest known animal in the world.[6][7][8] However, in 1864, a Bootlace worm was found washed up on a Scottish shore that was 180 feet long. But because bootlace worms can easily stretch to several times their natural length, it is possible the worm did not actually grow to be that length.

The bell is divided into eight lobes, giving it the appearance of an eight-pointed star. An ostentatiously tangled arrangement of colorful arms emanates from the centre of the bell, much shorter than the silvery, thin tentacles which emanate from the bell's subumbrella.

Size also dictates coloration—larger specimens are a vivid crimson to dark purple while smaller specimens grade to a lighter orange or tan. These jellyfish are understandably named for their showy, trailing tentacles reminiscent of a lion's mane.

Ecology

A coldwater species, this jellyfish cannot cope with warmer waters. The jellyfish are pelagic for most of their lives but tend to settle in shallow, sheltered bays towards the end of their one-year lifespan. In the open ocean, lion's mane jellyfish act as floating oases for certain species, such as shrimp, medusafish, butterfish, harvestfish, and juvenile prowfish, providing both a reliable source of food and protection from predators.

Predators of the lion's mane jellyfish include seabirds, larger fish, other jellyfish species, and sea turtles.[9] The jellyfish themselves feed mostly on zooplankton, small fish, ctenophores, and moon jellies.[10]

Behavior and reproduction

Small, dead Lion's Mane jelly washing up on the beach

Lion's mane jellyfish remain mostly very near the surface at no more than 20 m depth, their slow pulsations weakly driving them forwards; they depend on ocean currents whereby the jellies travel great distances. The jellyfish are most often spotted during the late summer and autumn, when they have grown to a large size and the currents begin to sweep them closer to shore.

Like other jellyfish, Lions manes are capable of both sexual reproduction in the medusa stage and asexual reproduction in the polyp stage.[9] Lion's mane jellyfish have four different stages in their year long life span, a larval stage, a polyp stage, an ephyrae stage and the medusa stage.[9] The female jellyfish carries its fertilized eggs in its tentacle where the eggs grow into larva. When the larva are old enough, the female deposits them on a hard surface where the larva soon grow into polyps. The polyps begin to reproduce asexually, creating stacks of small creatures called ephyraes.[11] The individual ephyraes break off the stacks, where they eventually grow into the medusa stage and become full grown jellyfish.[12]

Human contact

On July 21, 2010, 50 to 100 people are thought to have been stung by the remains of a dead Lion's mane jellyfish that had broken up into countless pieces in Rye, New Hampshire in the United States. Considering the size of the species, it is possible but not likely that this mass incident was caused by a single specimen.[13]

In popular culture

  • The Lion's mane jellyfish appears in the Sherlock Holmes short story The Adventure of the Lion's Mane published in The Case-Book of Sherlock Holmes. Holmes discovers at the end of the story that the true killer of a school professor who died shortly after going swimming was actually this jellyfish. Suspicion was originally laid upon the professor's rival in love, until the latter was similarly attacked (he survived, although badly stung). In the context of the story, it is only because the school professor has a weak heart that he succumbs, as is confirmed by the survival of the second victim.
  • Lion's mane jellyfish are an adoptable animal in the Microsoft video game: Zoo Tycoon: Marine Mania.

Gallery

References

  1. ^ "Waterford Today - Rare sighting of a lion’s mane jellyfish in Tramore Bay". Waterford-today.ie. http://www.waterford-today.ie/index.php?option=com_content&task=view&id=933&Itemid=10177&ed=68. Retrieved 2010-09-03. 
  2. ^ [1][dead link]
  3. ^ "Lion’s Mane Jellyfish - Reference Library". redOrbit. http://www.redorbit.com/education/reference_library/cnidaria/lions_mane_jellyfish/4326/index.html. Retrieved 2010-09-03. 
  4. ^ "Lion's Mane Jellyfish". Jellyfishfacts.net. http://www.jellyfishfacts.net/lions-mane-jellyfish.html. Retrieved 2010-09-03. 
  5. ^ "Lion's Mane Jellyfish". Scubatravel.co.uk. http://www.scubatravel.co.uk/lionsmane2.html. Retrieved 2010-09-03. 
  6. ^ "Giant Jellyfish". Extremescience.com. http://www.extremescience.com/GiantJellyfish.htm. Retrieved 2010-09-03. 
  7. ^ "Animal Records - National Zoo| FONZ". Nationalzoo.si.edu. http://nationalzoo.si.edu/Animals/AnimalRecords/. Retrieved 2010-09-03. 
  8. ^ "HowStuffWorks "What is the biggest animal ever to exist on Earth?"". Science.howstuffworks.com. http://science.howstuffworks.com/question687.htm. Retrieved 2010-09-03. 
  9. ^ a b c "Lions Mane Jellyfish". Types Of Jellyfish. http://www.typesofjellyfish.net/lions_mane_jellyfish/lions_mane_jellyfish.html. Retrieved 2010-09-03. 
  10. ^ "Giant Jellyfish". Extremescience.com. http://www.extremescience.com/zoom/index.php/life-in-the-deep-ocean/60-giant-jellyfish. Retrieved 2010-09-03. 
  11. ^ "SCDNR - Jelly fish". Dnr.sc.gov. http://www.dnr.sc.gov/marine/pub/seascience/jellyfi.html. Retrieved 2010-09-03. 
  12. ^ "Open ocean - Jellyfish life cycle - Te Ara Encyclopedia of New Zealand". Teara.govt.nz. 2009-03-02. http://www.teara.govt.nz/en/open-ocean/2/2. Retrieved 2010-09-03. 
  13. ^ POSTED: 3:12 pm EDT July 21, 2010 (2010-07-21). "150 Stung By Jellyfish At Rye Beach - New Hampshire News Story - WMUR Manchester". Wmur.com. http://www.wmur.com/news/24341753/detail.html. Retrieved 2010-09-03. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!