Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

WhyReef - Lifestyle

You can find the jeweled blenny wherever there is algae and seaweed, usually near coral or sandy areas. It will fight to protect its home! It doesn’t share its home with other blennies, and it will chase them away if they come too close. It is also very protective of its young; girl blennies lay eggs and then leave them to the boys blennies to guard until after they hatch!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit reef flats as well as shallow lagoon and seaward reefs. Also found in estuarine areas with algae-rich rubble patches on reef flats and slopes. Intertidal to a few meters depth (Ref. 48636). Usually found in areas of mixed coral, sand, and rubble (Ref. 9710). Feed by scraping off algae (Ref. 1602). Oviparous (Ref. 205). Eggs are demersal and adhesive (Ref. 205). Neither fang nor venom gland is present (Ref. 57406). Also Ref. 58652.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Fun Facts

Unlike most fish, the jeweled blenny has no scales. Instead, it has small feather-like growths on its head. These are called cirri and they help the jeweled blenny blend in with its habitat. Because the cirri make the jeweled blenny look similar to its surroundings, predators have a hard time seeing it.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to Samoa, north to the Ryukyu Islands, south to the Great Barrier Reef and New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Marshall Islands and Samoa, north to Ryukyu Islands, south to Western Australia, New Caledonia, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 18 - 20; Analspines: 2; Analsoft rays: 19 - 21
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits reef flats as well as shallow lagoons and seaward reefs. Feeds by scraping off algae (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Numerous pale spots, dark streaks anteriorly, and several dusky bands (Ref. 4404).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 8 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 108 specimens in 1 taxon.
Water temperature and chemistry ranges based on 69 samples.

Environmental ranges
  Depth range (m): 0.1 - 13.725
  Temperature range (°C): 24.659 - 29.336
  Nitrate (umol/L): 0.050 - 0.622
  Salinity (PPS): 32.019 - 35.373
  Oxygen (ml/l): 4.271 - 4.825
  Phosphate (umol/l): 0.055 - 0.415
  Silicate (umol/l): 0.974 - 5.501

Graphical representation

Depth range (m): 0.1 - 13.725

Temperature range (°C): 24.659 - 29.336

Nitrate (umol/L): 0.050 - 0.622

Salinity (PPS): 32.019 - 35.373

Oxygen (ml/l): 4.271 - 4.825

Phosphate (umol/l): 0.055 - 0.415

Silicate (umol/l): 0.974 - 5.501
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 8m.
Recorded at 8 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

WhyReef - Menu

The jeweled blenny eats algae, especially turf algae. Turf algae is a mix of many different species of algae living together, and is very common in the sea. The jeweled blenny will also eat zooplankton, which are microscopic animals that live in the sea. Since it eats both plants and animals, the jeweled blenny is an omnivore.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salarias fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCGACCAACCATAAAGATATTGGCACTCTTTACCTAGTCTTTGGTGCCTGAGCCGGAATAGTAGGAACTGCGCTAAGCCTCCTTATCCGGGCCGAGCTAAGCCAACCTGGCGCTCTCCTCGGGGAC---GACCAGATTTATAATGTAATCGTCACGGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGGCTTATCCCCCTAATAATTGGGGCCCCCGATATAGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTTCTCCCCCCATCGTTCCTTCTTCTGCTTGCCTCCTCCGGCGTAGAAGCCGGGGCCGGAACAGGATGAACTGTCTATCCCCCCCTTTCCGGCAACCTAGCCCATGCGGGTGCCTCAGTGGACCTAACAATCTTTTCTCTACACTTGGCGGGAGTTTCTTCAATTCTTGGGGCAATCAACTTCATCACCACAATCATTAATATGAAACCCCCCGCCATCTCCCAATATCAAACGCCCCTATTTGTTTGAGCAGTTCTTATTACGGCCGTCCTACTACTCCTTTCCCTTCCCGTTCTTGCCGCAGGCATCACCATGCTCCTTACCGACCGGAACCTAAACACCACCTTCTTTGACCCAGCTGGGGGAGGGGACCCGATTCTTTACCAACACTTATTCTGATTCTTTGGGCACCCCGAAGTCTACATCCTTATCCTCCCAGGATTCGGCATAATCTCGCACATTGTTGCCTATTACTCTGGTAAAAAAGAACCCTTCGGCTACATGGGCATGGTGTGAGCCATGATAGCAATCGGACTACTTGGGTTTATTGTTTGAGCCCACCACATGTTCACTGTAGGGATGGATGTTGACACACGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Salarias fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

WhyReef - Threats

Reefs are in danger, and that means so is my home!
Creative Commons Attribution 3.0 (CC BY 3.0)

© WhyReef

Source: WhyReef EOL content

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Salarias fasciatus

The jewelled blenny, Salarias fasciatus, is a popular marine aquarium fish species in Australasia. Despite being also known as the lawnmower blenny due to its propensity to consume algae growth from rocks and glass, it is principally a detritivore, with plant material making up only 15% of its diet. This species reaches a length of 14 centimetres (5.5 in) TL.[1] The lawnmower blenny is generally regarded as compatible with most other marine fish species and as a group with other lawnmower blennies.

The lawnmower blenny has the capability to blend it with its surroundings to hide itself from predators. It stays mostly on the ocean or aquarium floor or on any rock or corals.

Description[edit]

A small fish, with maximum recorded size of about 14cm. Body depth about 3.7 to 4.2 in length, head small, branched supraorbital and nuchal cirri. Lip margins smooth. No notch in dorsal fin, dorsal and anal fins attached to base of caudal fin by a membrane. Adult males have elongated anterior rays on the anal fin. Colour variable. Usually olive to brown with dark bars and a large number of round or elongated white spots of different sizes. There are usually dark longitudinal lines on the front part of the body, and small bright blue spots with dark outlines along the rear part of the body.[2]

Distribution[edit]

East Africa and the Red Sea to Samoa and the Islands of Micronesia[2]

Habitat[edit]

Usually seen on shallow reef flats with heavy algal cover.[2]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Salarias fasciatus" in FishBase. February 2013 version.
  2. ^ a b c Randall, John E.; Allen, Gerald R.; Steene, Roger C. (1997). Fishes of the Great Barrier Reef and Coral Sea (second ed.). Honolulu: University of Hawai'i Press. ISBN 0 8248 1895 4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!