Overview

Comprehensive Description

Biology

Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth (Ref. 30573). Benthopelagic (Ref. 58302). Feeds on plankton such as crab larvae. Caught at night (Ref. 30573).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa south to Natal, South Africa (except Red Sea, Gulf of Aden, Persian Gulf, Indian coast) and east to French Polynesia and the Hawaiian Islands; north to Tosa Bay, Shikoku (Japan), south to the Great Barrier Reef and Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Kenya, Madagascar, Mauritius, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Madagascar, Comores, Seychelles and Mascarenes east to Hawaiian Islands and Marquesas Islands, north to southern Japan and Ogasawara Islands, south to Western Australia, New Caledonia, Lord Howe Island, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 4; Analsoft rays: 14 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

26.0 cm TL (male/unsexed; (Ref. 48635))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body red dorsally, silvery pink below LL; reddish brown bar from upper end of gill opening to base of pectoral fins; fins red except for spinous dorsal which is translucent red basally and broadly yellow distally (Ref. 4201). Has smaller scales than most other similar species and the higher number along the body is quite obvious (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 55 m (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 129 specimens in 1 taxon.
Water temperature and chemistry ranges based on 90 samples.

Environmental ranges
  Depth range (m): 1 - 100
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.019 - 2.380
  Salinity (PPS): 33.568 - 36.142
  Oxygen (ml/l): 4.230 - 5.079
  Phosphate (umol/l): 0.088 - 0.308
  Silicate (umol/l): 0.506 - 4.989

Graphical representation

Depth range (m): 1 - 100

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.019 - 2.380

Salinity (PPS): 33.568 - 36.142

Oxygen (ml/l): 4.230 - 5.079

Phosphate (umol/l): 0.088 - 0.308

Silicate (umol/l): 0.506 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 55m.
From 2 to 55 meters.

Habitat: reef-associated. Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). Is a nocturnal planktivore that takes mostly crab megalops and other crustaceans (Ref. 13550).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis kuntee

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTTTAAGCCTTCTAATTCGAGCTGAGCTAAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTACAACGTAATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTCATCCCCCTAATGATTGGTGCCCCTGATATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTAGCCTCCTCAGGAGTAGAGGCCGGAGCCGGAACAGGATGAACCGTCTACCCACCCCTAGCAGGAAACCTAGCCCACGCAGGAGCTTCCGTTGATCTAACCATCTTTTCGCTTCACCTGGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAATTATCAACATGAAACCTCCAGCCATCTCTCAATACCAGACACCTCTGTTTGTTTGAGCAGTCCTAATTACGGCTGTCCTTCTTCTCCTATCCCTCCCTGTCCTTGCTGCTGGCATCACCATGCTTCTAACGGACCGAAACCTAAACACTACCTTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Myripristis kuntee

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!