Overview
Comprehensive Description
Biology
Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth (Ref. 30573). Benthopelagic (Ref. 58302). Feeds on plankton such as crab larvae. Caught at night (Ref. 30573).
-
Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
http://www.fishbase.org/references/FBRefSummary.php?id=12419&speccode=12596
Trusted
Distribution
Indo-Pacific: East Africa south to Natal, South Africa (except Red Sea, Gulf of Aden, Persian Gulf, Indian coast) and east to French Polynesia and the Hawaiian Islands; north to Tosa Bay, Shikoku (Japan), south to the Great Barrier Reef and Lord Howe Island.
-
Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
http://www.fishbase.org/references/FBRefSummary.php?id=12419&speccode=12596
Trusted
Chagos, Comores, Kenya, Madagascar, Mauritius, Reunion, Seychelles, Somalia, South Africa (country)
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Bock, K.R. (1996). Checklist of the reef fishes of Diani and Galu, Kenya. Journal of East African natural History 85: 5-22.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6357
Trusted
Indo-West Pacific: Madagascar, Comores, Seychelles and Mascarenes east to Hawaiian Islands and Marquesas Islands, north to southern Japan and Ogasawara Islands, south to Western Australia, New Caledonia, Lord Howe Island, and Tonga.
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 4; Analsoft rays: 14 - 16
-
Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
http://www.fishbase.org/references/FBRefSummary.php?id=4538&speccode=7184
Trusted
Size
Max. size
26.0 cm TL (male/unsexed; (Ref. 48635))
-
Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
http://www.fishbase.org/references/FBRefSummary.php?id=48635&speccode=11113
Trusted
Diagnostic Description
Body red dorsally, silvery pink below LL; reddish brown bar from upper end of gill opening to base of pectoral fins; fins red except for spinous dorsal which is translucent red basally and broadly yellow distally (Ref. 4201). Has smaller scales than most other similar species and the higher number along the body is quite obvious (Ref. 48635).
-
Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
http://www.fishbase.org/references/FBRefSummary.php?id=4538&speccode=7184
Trusted
Description
Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 2 - 55 m (Ref. 12419)
-
Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
http://www.fishbase.org/references/FBRefSummary.php?id=12419&speccode=12596
Trusted
Depth range based on 129 specimens in 1 taxon.
Water temperature and chemistry ranges based on 90 samples.
Environmental ranges
Depth range (m): 1 - 100
Temperature range (°C): 22.496 - 29.336
Nitrate (umol/L): 0.019 - 2.380
Salinity (PPS): 33.568 - 36.142
Oxygen (ml/l): 4.230 - 5.079
Phosphate (umol/l): 0.088 - 0.308
Silicate (umol/l): 0.506 - 4.989
Graphical representation
Depth range (m): 1 - 100
Temperature range (°C): 22.496 - 29.336
Nitrate (umol/L): 0.019 - 2.380
Salinity (PPS): 33.568 - 36.142
Oxygen (ml/l): 4.230 - 5.079
Phosphate (umol/l): 0.088 - 0.308
Silicate (umol/l): 0.506 - 4.989
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 90 samples.
Environmental ranges
Depth range (m): 1 - 100
Temperature range (°C): 22.496 - 29.336
Nitrate (umol/L): 0.019 - 2.380
Salinity (PPS): 33.568 - 36.142
Oxygen (ml/l): 4.230 - 5.079
Phosphate (umol/l): 0.088 - 0.308
Silicate (umol/l): 0.506 - 4.989
Graphical representation
Depth range (m): 1 - 100
Temperature range (°C): 22.496 - 29.336
Nitrate (umol/L): 0.019 - 2.380
Salinity (PPS): 33.568 - 36.142
Oxygen (ml/l): 4.230 - 5.079
Phosphate (umol/l): 0.088 - 0.308
Silicate (umol/l): 0.506 - 4.989
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 2 - 55m.
From 2 to 55 meters.
Habitat: reef-associated. Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
From 2 to 55 meters.
Habitat: reef-associated. Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
Trusted
Trophic Strategy
Inhabits coral reefs (Ref. 58534). Is a nocturnal planktivore that takes mostly crab megalops and other crustaceans (Ref. 13550).
-
Hobson, E.S. 1974 Feeding relationships of teleostean fishes on coral reefs in Kona, Hawaii. Fish. Bull. 72(4):915-1031. (Ref. 13550)
http://www.fishbase.org/references/FBRefSummary.php?id=13550&speccode=4734
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Myripristis kuntee
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTTTAAGCCTTCTAATTCGAGCTGAGCTAAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTACAACGTAATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTCATCCCCCTAATGATTGGTGCCCCTGATATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTAGCCTCCTCAGGAGTAGAGGCCGGAGCCGGAACAGGATGAACCGTCTACCCACCCCTAGCAGGAAACCTAGCCCACGCAGGAGCTTCCGTTGATCTAACCATCTTTTCGCTTCACCTGGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAATTATCAACATGAAACCTCCAGCCATCTCTCAATACCAGACACCTCTGTTTGTTTGAGCAGTCCTAATTACGGCTGTCCTTCTTCTCCTATCCCTCCCTGTCCTTGCTGCTGGCATCACCATGCTTCTAACGGACCGAAACCTAAACACTACCTTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Myripristis kuntee
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 22
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 22
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
-
Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306
-
Randall, J.E. 1984 Holocentridae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 2. (Ref. 3418)
http://www.fishbase.org/references/FBRefSummary.php?id=3418&speccode=26201
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


