Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth (Ref. 30573). Benthopelagic (Ref. 58302). Feeds on plankton such as crab larvae. Caught at night (Ref. 30573).
  • Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa south to Natal, South Africa (except Red Sea, Gulf of Aden, Persian Gulf, Indian coast) and east to French Polynesia and the Hawaiian Islands; north to Tosa Bay, Shikoku (Japan), south to the Great Barrier Reef and Lord Howe Island.
  • Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Madagascar, Comores, Seychelles and Mascarenes east to Hawaiian Islands and Marquesas Islands, north to southern Japan and Ogasawara Islands, south to Western Australia, New Caledonia, Lord Howe Island, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 4; Analsoft rays: 14 - 16
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

26.0 cm TL (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body red dorsally, silvery pink below LL; reddish brown bar from upper end of gill opening to base of pectoral fins; fins red except for spinous dorsal which is translucent red basally and broadly yellow distally (Ref. 4201). Has smaller scales than most other similar species and the higher number along the body is quite obvious (Ref. 48635).Description: Characterized by third and fourth anal spines about equal length; axil of pectoral fins without scales; body depth 2.2-2.6 in SL (Ref 90102).
  • Myers, R.F. 1989 Micronesian reef fishes: A practical guide to the identification of the inshore marine fishes of the tropical central and western Pacific. First Edition. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 4538)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 55 m (Ref. 12419)
  • Randall, J.E. and D.W. Greenfield 1996 Revision of the Indo-Pacific holocentrid fishes of the genus Myripristis, with descriptions of three new species. Indo-Pac. Fish. (25):61 p. (Ref. 12419)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 129 specimens in 1 taxon.
Water temperature and chemistry ranges based on 90 samples.

Environmental ranges
  Depth range (m): 1 - 100
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.019 - 2.380
  Salinity (PPS): 33.568 - 36.142
  Oxygen (ml/l): 4.230 - 5.079
  Phosphate (umol/l): 0.088 - 0.308
  Silicate (umol/l): 0.506 - 4.989

Graphical representation

Depth range (m): 1 - 100

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.019 - 2.380

Salinity (PPS): 33.568 - 36.142

Oxygen (ml/l): 4.230 - 5.079

Phosphate (umol/l): 0.088 - 0.308

Silicate (umol/l): 0.506 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 55m.
From 2 to 55 meters.

Habitat: reef-associated. Lives in subtidal reef flats, also in lagoon and seaward reefs below the surge zone to depths of at least 26 m. Often occurs in large aggregations during the day in areas of rich foliaceous or cavernous coral growth. Feeds on plankton such as crab larvae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534). Is a nocturnal planktivore that takes mostly crab megalops and other crustaceans (Ref. 13550).
  • Hobson, E.S. 1974 Feeding relationships of teleostean fishes on coral reefs in Kona, Hawaii. Fish. Bull. 72(4):915-1031. (Ref. 13550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Myripristis kuntee

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTAGTATTTGGCGCCTGAGCCGGGATGGTCGGCACCGCTTTAAGCCTTCTAATTCGAGCTGAGCTAAGCCAACCCGGAGCTCTTCTGGGCGACGACCAGATTTACAACGTAATCGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTCATCCCCCTAATGATTGGTGCCCCTGATATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCCTCCTAGCCTCCTCAGGAGTAGAGGCCGGAGCCGGAACAGGATGAACCGTCTACCCACCCCTAGCAGGAAACCTAGCCCACGCAGGAGCTTCCGTTGATCTAACCATCTTTTCGCTTCACCTGGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAATTATCAACATGAAACCTCCAGCCATCTCTCAATACCAGACACCTCTGTTTGTTTGAGCAGTCCTAATTACGGCTGTCCTTCTTCTCCTATCCCTCCCTGTCCTTGCTGCTGGCATCACCATGCTTCTAACGGACCGAAACCTAAACACTACCTTCTTCGACCCAGCTGGAGGAGGAGACCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myripristis kuntee

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
  • Randall, J.E. 1984 Holocentridae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 2. (Ref. 3418)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!