You are viewing this Species as classified by:

Overview

Brief Summary

The red-bellied piranha or red piranha (Pygocentrus nattereri) is a species of piranhanative to South America, found in the Amazon River Basin, coastal rivers of northeasternBrazil, and the basins of the Paraguay and Paraná. The red-bellied piranha has a popular reputation as a ferocious predator, despite being primarily scavengers. As their name suggests, red-bellied piranhas have a reddish tinge to the belly when fully grown, although juveniles are a silver colour with darker spots. They grow to a maximum length of 33 centimetres (13 in) and a weight of 3.5 kilograms (7.7 lb). The way to distinguish males from females is that the female has a slightly deeper color of red on her belly.

Read more...

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia Editors and contributors

Supplier: Jeff Holmes

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Common in creeks and interconnected ponds in Matto Grosso, Brazil, where it influences distribution and feeding of other fish (Ref. 9080) and in areas of high primary production in Rio Machado and Rio Negro (Ref.9096). Adults feed mainly at dusk and dawn. Feeds on insects, worms and fish (Ref. 7020). Medium-sized to large individuals (15-24 cm length) forage mainly at dawn, late afternoon and night up to about 2200H, whereas smaller fish (8-11 cm) are active mainly during the day (Ref. 9080). Teeth replacement on alternating sides of jaw allows continuous feeding. Its powerful dentition can inflict serious bites. Has a highly evolved auditory capacity and a 'lurking', then 'dashing' behavior during daytime. Shows hierarchies within small schools (Ref. 9077). Available information on body composition of 'piranha caju' flesh is 8.2% fat, 15.0% protein and 4.4% ash (Ref. 9251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

South America: Amazon River basin, Paraguay-Paraná River basin, northeastern Brazilian coastal rivers and Essequibo River basin (Ref. 39031). Reported from the Uruguay River, Brazil (Ref. 79585).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pygocentrus nattereri is found in South America. Pygocentrus nattereri can be found east of the Andes in the Parana-Paraguay and Amazon basin. They can also be found in rivers of northeast Brazil and the Guianas.

Biogeographic Regions: neotropical (Native )

  • Fink, W. 1993. Revision of the Piranha Genus Pygocentrus (Teleostei, Characiformes). Copeia, 3: 665-686.
  • Uetanabaro, M., T. Wang, A. Abe. 1993. Breeding Behaviour of the Red-Bellied Piranha, Pygocentrus nattereri, in nature. Environmental Biology of Fishes, 38: 369-371.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Reported but unconfirmed

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to South America. Reported from 10 states, including Florida, Hawaii, Massachusetts, Michigan, Minnesota, Ohio, Oklahoma, Pennsylvania, Texas, and Virginia (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Amazon River basin, Paraguay-Paraná River basin, northeastern Brazilian coastal rivers and Essequibo River basin: Argentina, Bolovia, Brazil, Colombia, Ecuador, Guyana, Paraguay, Peru and Uruguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 16 - 18; Analspines: 0; Analsoft rays: 27 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Pygocentrus nattereri physical characteristics vary with location, population, and age. In juvenile P. nattereri there are differences in physical characteristics depending on the size of the fish. A change in color pattern does seem to develop as size increases. The thickening body tissue tends to cause the black internal line of the anal fin to disappear and both the number of body spots and the density of melanophores increases with growth. Adult specimens also tend to vary in color pattern and body size with geographic location. Generally P. nattereri is reddish-orange ventrally and silver-gray dorsally. The fins vary in color as well, with a black dorsal fin, black anal fin, and reddish-orange pectoral fins. The lateral color of the fish is a gray to silver- gray.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 333 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm SL (male/unsexed; (Ref. 81048)); max. published weight: 3,850 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Pygocentrus nattereri
Catalog Number: USNM 21432
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Orton
Locality: Napo or Maranon River, Ecuador/Peru, Peru, South America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic; freshwater; pH range: 5.5 - 7.5; dH range: 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pygocentrus nattereri is typically found in whitewater streams in South America (Saint-Paul 2000). However, the species is not found typically in blackwater streams (Fink 1993)

Habitat Regions: tropical ; freshwater

Aquatic Biomes: rivers and streams

  • Saint-Paul, U., J. Zuanon, M. Correa, M. Garcia, N. Fabre. March 2000. Fish Communities in Central Amazonian White- and Blackwater floodplains. Environmental Biology of Fishes, 57: 235-250.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Common in creeks and interconnected ponds in Matto Grosso, Brazil, where it influences distribution and feeding of other fish (Ref. 9080) and in areas of high primary production in Rio Machado and Rio Negro (Ref.9096). Adults feed mainly at dusk and dawn. Feeds on insects, worms and fish (Ref. 7020). Medium-sized to large individuals (15-24 cm length) forage mainly at dawn, late afternoon and night up to about 2200H, whereas smaller fish (8-11 cm) are active mainly during the day (Ref. 9080). Teeth replacement on alternating sides of jaw allows continuous feeding. Its powerful dentition can inflict serious bites. Has a highly evolved auditory capacity and a 'lurking', then 'dashing' behavior during daytime. Shows hierarchies within small schools (Ref. 9077).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Foraging methods vary in different life stages of P. nattereri. During the day, smaller fish (80-110 mm) search for food. At dawn, late afternoon, and early evening the larger fish (150-240 mm) search for food. Pygocentrus nattereri groups gather in vegetation in order to wait for prey. The group typically includes around 20-30 fishes. In the daytime P. nattereri can be seen lurking or ambushing prey. Two other methods for obtaining food employed by P. nattereri are chasing and scavenging. The hunting mode of chasing was seen after the fish lie and wait in vegetation. The fish then proceed to swim after and eat the fish. P. nattereri has a wide variety of food in its diet, including fins, scales, fish (pieces and whole), insects, snails, and plants. The plant intake of the animal may be an active way of gaining food supplies while scanning for prey.

Animal Foods: fish; carrion ; insects; mollusks

Plant Foods: leaves; fruit

Primary Diet: omnivore

  • Sazima, I., F. Machado. 1990. Underwater Observations of Piranhas in Western Brazil. Environmental Biology of Fishes, 28: 17-31.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

An interesting relationship between P. nattereri and Serrasalmus marginatus has developed. Serrasalmus marginatus has been seen taking crustacean parasites off the bodies of P. nattereri.

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Procamallanus Infection 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eustrongylides Infestation 2 (Larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Males and females appear externally alike (Refs. 2279 & 9245). In 'Serrasalmus sp. aff. nattereri', reported to occur in the Orinoco basin (Venezuela, Guyana), the males have more 'bull-like' heads, but are more slender than females (Ref. 1672). Eggs are laid on tree roots trailing in the water and are guarded; the reproductive success may vary strongly from year to year depending on how the savanna was flooded (Ref. 9078). The eggs are large, adhere to plants and are not attacked by the parents. They hatch in 9 to10 days (Ref. 7020).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Pygocentrus nattereri seems to have a type of courtship display that involves swimming in circles. This results in ventral-to-ventral interactions among the male and female. Eggs are placed in the sediment, in bowl shaped nests. These nests are around 4-5 cm in depth and 15 cm in diameter. The eggs are in clusters and are attached to the bottom vegetation. There may also be a relationship between the times of the spawning and the time of the wet season.

Breeding season: Spawning seems to occur during the wet season.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

  • Uetanabaro, M., T. Wang, A. Abe. 1993. Breeding Behaviour of the Red-Bellied Piranha, Pygocentrus nattereri, in nature. Environmental Biology of Fishes, 38: 369-371.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pygocentrus nattereri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACAATCACACGCTGATTCTTCTCCACCAACCACAAAGACATTGGCACCCTCTACCTAGTATTTGGTGCATGAGCCGGAATAGTTGGAACCGCCCTCAGCCTCTTAATTCGAGCAGAGCTCAGTCAACCCGGATCCCTACTGGGCGACGATCAGATCTATAATGTTATCGTTACTGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTCGGAAACTGACTAGTTCCCCTAATGATTGGCGCGCCCGACATAGCATTTCCCCGAATGAATAACATAAGTTTCTGACTTCTTCCCCCATCCTTTCTTCTCCTCCTAGCATCTTCAGGGGTTGAGGCTGGAGCCGGGACAGGTTGAACCGTCTACCCCCCACTTGCCGGAAACCTTGCACACGCCGGAGCTTCTGTAGACCTAACTATTTTTTCCCTACACCTCGCCGGGGTCTCTTCCATCCTTGGGGCCATTAACTTTATCACAACCATCATCAACATAAAACCCCCAGCCATCTCACAATATCAAACACCCCTATTCGTCTGAGCCGTCCTAATCACTGCTGTTCTCCTCCTCCTTTCCCTGCCAGTCCTGGCCGCCGGGATTACAATACTTCTTACAGATCGGAACCTAAACACCACATTCTTTGACCCCGCGGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGGTTCTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGGATGATTTCACACATTGTAGCTTACTACGCGGGCAAAAAAGAGCCTTTCGGCTATATAGGAATGGTTTGAGCTATAATAGCAATCGGGCTTCTAGGCTTTATCGTGTGAGCCCACCACATGTTCACGGTAGGAATGGACGTAGACACCCGAGCATACTTCACATCTGCAACAATAATCATTGCAATCCCAACAGGAGTAAAAGTATTTAGCTGACTAGCCACACTCCACGGAGGTGCTATTAAATGAGAGACCCCTATGCTATGGGCCCTGGGATTCATCTTCCTATTTACAGTTGGGGGTCTTACAGGAATTGTCCTAGCCAACTCCTCTCTTGACATTATACTCCACGACACGTACTACGTAGTTGCCCACTTCCACTACGTCCTATCTATGGGGGCCGTATTTGCCATCATAGGGGCCTTCGTCCACTGATTCCCCCTATTCTCCGGCTATGCACTCCACAGCACCTGAACAAAAATCCACTTCGGAATCATATTTGTGGGTGTTAACCTCACTTTCTTCCCACAACATTTCCTTGGCCTAGCCGGTATACCACGACGATACTCCGACTACCCGGACGCCTACGCCCTCTGAAACACAATCTCCTCAATCGGCTCTTTAATTTCTCTAATTGCAGTAATTATGTTCCTATTTATCCTGTGAGAAGCCTTCACCGCTAAACGAGAAGTCCTATCCGTCGAACTAACCACCACAAACGCGGAATGACTCCACGGGTGCCCCCCTCCCTACCACACATTTGAAGAACCGGCATTTGTCCAAGTCCAATCATGACGAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pygocentrus nattereri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Pygocentrus nattereri has been introduced to the freshwaters of the United States on numerous occasions. Introductions have been reported in Florida, Hawaii, Massachusetts, Michigan, Minnesota, Ohio, Oklahoma, Pennsylvania, Texas, and Virginia. The fishes were probably releases from aquariums. When a piranha is found in a lake, many state agencies use the chemical rotenone to kill the fishes.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Pygocentrus nattereri is considered one of the more dangerous and aggressive species of piranha.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Pygocentrus nattereri is one of the most commonly used piranhas in the aquarium trade.

Positive Impacts: pet trade

  • Fuller, P., L. Nico, J. Williams. 1999. Nonindigenous Fishes Introduced into Inland Waters of the United States. Bethesda, Maryland: American Fisheries Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-bellied piranha

The red-bellied piranha or red piranha (Pygocentrus nattereri) is a species of piranha native to South America, found in the Amazon River Basin, coastal rivers of northeastern Brazil, and the basins of the Paraguay and Paraná.[1] The red-bellied piranha has a popular reputation as a ferocious predator, despite being primarily scavengers.[2] As their name suggests, red-bellied piranhas have a reddish tinge to the belly when fully grown, although juveniles are a silver colour with darker spots. They grow to a maximum length of 33 centimetres (13 in) and a weight of 3.5 kilograms (7.7 lb). The way to distinguish males from females is that the female has a slightly deeper color of red on her belly.

Contents

Diet [edit]

Their diet consists largely of fish, insects, worms, crustaceans, and the occasional larger animal. In contrast to their popular reputation of feeding on live animals, red-bellied piranhas usually feed on dead, dying, and injured vertebrates in the wild, but have been known to attack healthy animals. The fish usually feed in large schools around dusk and dawn. They locate their prey by scent or motion using a set of sensors down the sides of their bodies, the lateral line system.

Breeding [edit]

Red-bellied piranha usually spawn around April and May during the rainy season. The male will build a dug-out nest in rocks and vegetation, awaiting a female. Females can lay up to 1000 eggs[3] which the male fertilizes. Males become extremely territorial during spawning, and will prevent other fish from approaching the nest. After the eggs hatch, both parents guard the broods.

Red-bellied piranha in media [edit]

Many myths surround this species. The 1978 film Piranha by Joe Dante shows these fish in a similar light to Jaws. Piranha was followed by a sequel, Piranha II: The Spawning, in 1981, and two remakes, one in 1995, and one in 2010. Films such as these, and stories of large schools of red-bellies attacking humans, fuels their exaggerated and erroneous reputation as being one of the most ferocious freshwater fish. In reality, they are generally timid scavengers, fulfilling a role similar to vultures on land. In the 2010 film Piranha 3D, Christopher Lloyd's character identifies a specimen of the fictional monstrous piranha, specifically as Pygocentrus nattereri, but erroneously refers to them as the first piranhas, when in reality, red-bellied piranha are most likely not the "original" species.[citation needed]

In an aquarium [edit]

Red-bellied piranhas are sometimes kept as aquarium fish. Their natural diet consists of live prey and dead animals and fish. Live feedings to captive piranhas can introduce diseases, and goldfish contain a growth-inhibiting hormone which in turn will affect piranhas. Red-bellied piranhas, particularly when juvenile, will sometimes bite one another in the aquarium, normally on the fins, in behaviour called 'fin nipping'. Fish that have had their fins nipped will grow them back surprisingly rapidly.

References [edit]

  1. ^ "Animal Diversity Web: Pygocentrus nattereri". Animal Diversity Web. University of Michigan. 
  2. ^ "BBC Nature Red-bellied piranhas". BBC Nature Wildlife. BBC. Retrieved 10 December 2012. 
  3. ^ "Red Bellied Piranha (Serrasalmus nattereri)". Marwell Animal Encyclopedia. Marshwell Wildlife. Retrieved 24 January 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as Serrasalmus nattereri (red-bellied piranha); referred to as Pygocentrus nattereri (red piranha) in 1991 AFS list (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!