Overview

Brief Summary

The red-bellied piranha or red piranha (Pygocentrus nattereri) is a species of piranhanative to South America, found in the Amazon River Basin, coastal rivers of northeasternBrazil, and the basins of the Paraguay and Paraná. The red-bellied piranha has a popular reputation as a ferocious predator, despite being primarily scavengers. As their name suggests, red-bellied piranhas have a reddish tinge to the belly when fully grown, although juveniles are a silver colour with darker spots. They grow to a maximum length of 33 centimetres (13 in) and a weight of 3.5 kilograms (7.7 lb). The way to distinguish males from females is that the female has a slightly deeper color of red on her belly.

Read more...

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia Editors and contributors

Supplier: Jeff Holmes

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Common in creeks and interconnected ponds in Matto Grosso, Brazil, where it influences distribution and feeding of other fish (Ref. 9080) and in areas of high primary production in Rio Machado and Rio Negro (Ref.9096). Adults feed mainly at dusk and dawn. Feeds on insects, worms and fish (Ref. 7020). Medium-sized to large individuals (15-24 cm length) forage mainly at dawn, late afternoon and night up to about 2200H, whereas smaller fish (8-11 cm) are active mainly during the day (Ref. 9080). Teeth replacement on alternating sides of jaw allows continuous feeding. Its powerful dentition can inflict serious bites. Has a highly evolved auditory capacity and a 'lurking', then 'dashing' behavior during daytime. Shows hierarchies within small schools (Ref. 9077). Available information on body composition of 'piranha caju' flesh is 8.2% fat, 15.0% protein and 4.4% ash (Ref. 9251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Unknown/Undetermined

Confidence: Reported but unconfirmed

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to South America. Reported from 10 states, including Florida, Hawaii, Massachusetts, Michigan, Minnesota, Ohio, Oklahoma, Pennsylvania, Texas, and Virginia (Fuller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

South America: Amazon River basin, Paraguay-Paraná River basin, northeastern Brazilian coastal rivers and Essequibo River basin (Ref. 39031). Reported from the Uruguay River, Brazil (Ref. 79585).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Pygocentrus nattereri is found in South America. Pygocentrus nattereri can be found east of the Andes in the Parana-Paraguay and Amazon basin. They can also be found in rivers of northeast Brazil and the Guianas.

Biogeographic Regions: neotropical (Native )

  • Fink, W. 1993. Revision of the Piranha Genus Pygocentrus (Teleostei, Characiformes). Copeia, 3: 665-686.
  • Uetanabaro, M., T. Wang, A. Abe. 1993. Breeding Behaviour of the Red-Bellied Piranha, Pygocentrus nattereri, in nature. Environmental Biology of Fishes, 38: 369-371.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amazon River basin, Paraguay-Paraná River basin, northeastern Brazilian coastal rivers and Essequibo River basin: Argentina, Bolovia, Brazil, Colombia, Ecuador, Guyana, Paraguay, Peru and Uruguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 16 - 18; Analspines: 0; Analsoft rays: 27 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Pygocentrus nattereri physical characteristics vary with location, population, and age. In juvenile P. nattereri there are differences in physical characteristics depending on the size of the fish. A change in color pattern does seem to develop as size increases. The thickening body tissue tends to cause the black internal line of the anal fin to disappear and both the number of body spots and the density of melanophores increases with growth. Adult specimens also tend to vary in color pattern and body size with geographic location. Generally P. nattereri is reddish-orange ventrally and silver-gray dorsally. The fins vary in color as well, with a black dorsal fin, black anal fin, and reddish-orange pectoral fins. The lateral color of the fish is a gray to silver- gray.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 333 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm SL (male/unsexed; (Ref. 81048)); max. published weight: 3,850 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Pygocentrus nattereri
Catalog Number: USNM 21432
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Orton
Locality: Napo or Maranon River, Ecuador/Peru, Peru, South America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic; freshwater; pH range: 5.5 - 7.5; dH range: 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygocentrus nattereri is typically found in whitewater streams in South America (Saint-Paul 2000). However, the species is not found typically in blackwater streams (Fink 1993)

Habitat Regions: tropical ; freshwater

Aquatic Biomes: rivers and streams

  • Saint-Paul, U., J. Zuanon, M. Correa, M. Garcia, N. Fabre. March 2000. Fish Communities in Central Amazonian White- and Blackwater floodplains. Environmental Biology of Fishes, 57: 235-250.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Common in creeks and interconnected ponds in Matto Grosso, Brazil, where it influences distribution and feeding of other fish (Ref. 9080) and in areas of high primary production in Rio Machado and Rio Negro (Ref.9096). Adults feed mainly at dusk and dawn. Feeds on insects, worms and fish (Ref. 7020). Medium-sized to large individuals (15-24 cm length) forage mainly at dawn, late afternoon and night up to about 2200H, whereas smaller fish (8-11 cm) are active mainly during the day (Ref. 9080). Teeth replacement on alternating sides of jaw allows continuous feeding. Its powerful dentition can inflict serious bites. Has a highly evolved auditory capacity and a 'lurking', then 'dashing' behavior during daytime. Shows hierarchies within small schools (Ref. 9077).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Foraging methods vary in different life stages of P. nattereri. During the day, smaller fish (80-110 mm) search for food. At dawn, late afternoon, and early evening the larger fish (150-240 mm) search for food. Pygocentrus nattereri groups gather in vegetation in order to wait for prey. The group typically includes around 20-30 fishes. In the daytime P. nattereri can be seen lurking or ambushing prey. Two other methods for obtaining food employed by P. nattereri are chasing and scavenging. The hunting mode of chasing was seen after the fish lie and wait in vegetation. The fish then proceed to swim after and eat the fish. P. nattereri has a wide variety of food in its diet, including fins, scales, fish (pieces and whole), insects, snails, and plants. The plant intake of the animal may be an active way of gaining food supplies while scanning for prey.

Animal Foods: fish; carrion ; insects; mollusks

Plant Foods: leaves; fruit

Primary Diet: omnivore

  • Sazima, I., F. Machado. 1990. Underwater Observations of Piranhas in Western Brazil. Environmental Biology of Fishes, 28: 17-31.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

An interesting relationship between P. nattereri and Serrasalmus marginatus has developed. Serrasalmus marginatus has been seen taking crustacean parasites off the bodies of P. nattereri.

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Procamallanus Infection 10. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ichthyobodo Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eustrongylides Infestation 2 (Larvae). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Males and females appear externally alike (Refs. 2279 & 9245). In 'Serrasalmus sp. aff. nattereri', reported to occur in the Orinoco basin (Venezuela, Guyana), the males have more 'bull-like' heads, but are more slender than females (Ref. 1672). Eggs are laid on tree roots trailing in the water and are guarded; the reproductive success may vary strongly from year to year depending on how the savanna was flooded (Ref. 9078). The eggs are large, adhere to plants and are not attacked by the parents. They hatch in 9 to10 days (Ref. 7020).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Pygocentrus nattereri seems to have a type of courtship display that involves swimming in circles. This results in ventral-to-ventral interactions among the male and female. Eggs are placed in the sediment, in bowl shaped nests. These nests are around 4-5 cm in depth and 15 cm in diameter. The eggs are in clusters and are attached to the bottom vegetation. There may also be a relationship between the times of the spawning and the time of the wet season.

Breeding season: Spawning seems to occur during the wet season.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

  • Uetanabaro, M., T. Wang, A. Abe. 1993. Breeding Behaviour of the Red-Bellied Piranha, Pygocentrus nattereri, in nature. Environmental Biology of Fishes, 38: 369-371.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pygocentrus nattereri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACAATCACACGCTGATTCTTCTCCACCAACCACAAAGACATTGGCACCCTCTACCTAGTATTTGGTGCATGAGCCGGAATAGTTGGAACCGCCCTCAGCCTCTTAATTCGAGCAGAGCTCAGTCAACCCGGATCCCTACTGGGCGACGATCAGATCTATAATGTTATCGTTACTGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTCGGAAACTGACTAGTTCCCCTAATGATTGGCGCGCCCGACATAGCATTTCCCCGAATGAATAACATAAGTTTCTGACTTCTTCCCCCATCCTTTCTTCTCCTCCTAGCATCTTCAGGGGTTGAGGCTGGAGCCGGGACAGGTTGAACCGTCTACCCCCCACTTGCCGGAAACCTTGCACACGCCGGAGCTTCTGTAGACCTAACTATTTTTTCCCTACACCTCGCCGGGGTCTCTTCCATCCTTGGGGCCATTAACTTTATCACAACCATCATCAACATAAAACCCCCAGCCATCTCACAATATCAAACACCCCTATTCGTCTGAGCCGTCCTAATCACTGCTGTTCTCCTCCTCCTTTCCCTGCCAGTCCTGGCCGCCGGGATTACAATACTTCTTACAGATCGGAACCTAAACACCACATTCTTTGACCCCGCGGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGGTTCTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGGATGATTTCACACATTGTAGCTTACTACGCGGGCAAAAAAGAGCCTTTCGGCTATATAGGAATGGTTTGAGCTATAATAGCAATCGGGCTTCTAGGCTTTATCGTGTGAGCCCACCACATGTTCACGGTAGGAATGGACGTAGACACCCGAGCATACTTCACATCTGCAACAATAATCATTGCAATCCCAACAGGAGTAAAAGTATTTAGCTGACTAGCCACACTCCACGGAGGTGCTATTAAATGAGAGACCCCTATGCTATGGGCCCTGGGATTCATCTTCCTATTTACAGTTGGGGGTCTTACAGGAATTGTCCTAGCCAACTCCTCTCTTGACATTATACTCCACGACACGTACTACGTAGTTGCCCACTTCCACTACGTCCTATCTATGGGGGCCGTATTTGCCATCATAGGGGCCTTCGTCCACTGATTCCCCCTATTCTCCGGCTATGCACTCCACAGCACCTGAACAAAAATCCACTTCGGAATCATATTTGTGGGTGTTAACCTCACTTTCTTCCCACAACATTTCCTTGGCCTAGCCGGTATACCACGACGATACTCCGACTACCCGGACGCCTACGCCCTCTGAAACACAATCTCCTCAATCGGCTCTTTAATTTCTCTAATTGCAGTAATTATGTTCCTATTTATCCTGTGAGAAGCCTTCACCGCTAAACGAGAAGTCCTATCCGTCGAACTAACCACCACAAACGCGGAATGACTCCACGGGTGCCCCCCTCCCTACCACACATTTGAAGAACCGGCATTTGTCCAAGTCCAATCATGACGAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pygocentrus nattereri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pygocentrus nattereri has been introduced to the freshwaters of the United States on numerous occasions. Introductions have been reported in Florida, Hawaii, Massachusetts, Michigan, Minnesota, Ohio, Oklahoma, Pennsylvania, Texas, and Virginia. The fishes were probably releases from aquariums. When a piranha is found in a lake, many state agencies use the chemical rotenone to kill the fishes.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Pygocentrus nattereri is considered one of the more dangerous and aggressive species of piranha.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Pygocentrus nattereri is one of the most commonly used piranhas in the aquarium trade.

Positive Impacts: pet trade

  • Fuller, P., L. Nico, J. Williams. 1999. Nonindigenous Fishes Introduced into Inland Waters of the United States. Bethesda, Maryland: American Fisheries Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-bellied piranha

The red-bellied piranha or red piranha (Pygocentrus nattereri) is a species of piranha native to South America, found in the Amazon River Basin, coastal rivers of northeastern Brazil, and the basins of the Paraguay and Paraná.[1] They are omnivorous foragers and feed on insects, worms, crustaceans and fish. They are not a migratory species, but do travel to seek out conditions conducive to breeding and spawning during periods of increased rainfall. Red-bellied piranhas often travel in shoals as a predatory defense, but rarely exhibit group hunting behavior. Acoustic communication is common, and is sometimes exhibited along with aggressive behaviors. At this time, the red-bellied piranha is not considered to be a threatened species by the IUCN, and therefore, there are no conservation strategies in place to target this species. Through media influence, the red-bellied piranha has developed a reputation as a ferocious predator, though this is not actually the case. They are a popular aquarium fish.

Taxonomy and phylogeny[edit]

The red-bellied piranha belongs to the subfamily Serrasalminae, which is a group of medium to large-sized characids and includes other closely related omnivores such as pacus.[2] They are characterized by deep, lateral compressed bodies and long dorsal fins.[3] Within the subfamily, red-bellied piranhas fall into the genera Pygocentrus, which is distinguished by the unusual dentition and differing head width dimensions. The red-bellied piranha is considered to be highly carnivorous, while most non-piranhas in the family are primarily herbivorous. However, it should be noted that red-bellied piranha is actually omnivorous.[3]

Distribution and habitat[edit]

The red-bellied piranha is distributed widely throughout the South American continent and is found in the Neotropical freshwater rivers of Argentina, Brazil, Bolivia, Colombia, Ecuador, Guyana, Paraguay, Peru, Uruguay, and Venezuela.[4] They live in the warm freshwater drainages of several major rivers including the Amazon, Rio Paraguay, Rio Paraná and Rio Essequibo, as well as numerous smaller systems.[5] It is acclimated to waters that are between 15 and 35 °C and have a pH of 6 to 7 [6] and is typically found in white water rivers and some freshwater streams and lakes. In the Brazilian Amazon, the red-bellied piranha may sometimes inhabit flooded forests.[4]

Description[edit]

The red-bellied piranha has a popular reputation as a ferocious predator, despite being primarily a scavenger.[7] As their name suggests, red-bellied piranhas have a reddish tinge to the belly when fully grown, although juveniles are a silver colour with darker spots. They grow to a maximum length of 33 centimetres (13 in) and a weight of 3.5 kilograms (7.7 lb). The rest of the body is often gray with silver-flecked scales. Sometimes, blackish spots appear behind the gills and the anal fin is usually black at the base. The pectoral and pelvic fins may vary from red to orange. Females can be distinguished from males by the slightly deeper red color of their bellies.[4]

The red-bellied piranha is typically found in white water rivers, such as the Amazon River Basin, and in some streams and lakes. Sometimes, they may inhabit flooded forests such as those found in the Brazilian Amazon. They live in shoals but do not do group hunting behavior, although they may occasionally enter into feeding frenzies. In the case of a feeding frenzy, schools of piranha will converge on one large prey individual, and eat it within minutes. These attacks are usually extremely rare and are due to provocation or starvation. Breeding occurs over a two month period during the rainy season, but that can vary by area. Females will lay around 5,000 eggs on newly submerged vegetation in nests that are built by the males.[4]

Behavior[edit]

Pygocentrus nattereri encompasses a larger geographic area than any other piranha species, covering much of the Neotropical region. When red-bellied piranhas are introduced to other parts of the American continent, there are usually negative consequences for the local fish fauna,[8] partially due to its generally aggressive behavior. This aggressive behavior is sometimes marked by the acoustic sounds they produce.[9]

The red-bellied piranha is not a migratory species, but does search for conditions conducive to reproduction during seasons of increased rainfall. Red-bellied piranhas are omnivores and primarily foragers. They feed on insects, fish, plants, and organic debris.[10]

Diet and Feeding Behavior[edit]

The typical diet of red-bellied piranhas includes insects, worms, crustaceans, and fish.[11] In packs up to hundreds, piranhas have been known to feed on animals as large as egrets or capybara. Despite the piranha’s reputation as a dangerous carnivore, it is actually primarily scavengers and foragers, and will mainly eat plants and insects during the rainy season when food is abundant.[12] They also tend to only feed on weak, injured, dying, or dead animals in the wild.[11] Red-bellied piranhas do not stay in groups in order to pack-hunt for larger animals, but instead group for protection against predators.

Foraging methods vary throughout the different stages of a piranha's life. Smaller fish will search for food during the day, while larger fish will forage at dawn, in the late afternoon, and in the early evening. Throughout the day, the fish lurk in dark areas and ambush their prey. The piranha may also catch prey by hunting and chasing, where it will lie hidden in the vegetation until its prey swims by. The piranha will then capture its prey. When scavenging, the piranha will eat a wide variety of food, ranging from pieces of debris, insects, snails, fish fins and scales, and plants.[10]

Reproduction[edit]

The breeding habits of piranhas in nature are mostly unknown, with most spawning research being done in aquaria.[13] Piranhas are usually able to breed by the time they are one year old. Female piranhas will lay several thousand eggs near water plants, onto which the eggs stick. The males then fertilize the eggs. After just two to three days the eggs will hatch, and the juvenile piranhas will hide in the plants until they are large enough to defend themselves.[11]

Research on red-bellied piranha breeding behavior in nature has revealed certain behavioral patterns around nesting sites. Adult piranhas will swim side-by-side in small circles, sometimes with two individuals swimming in opposite directions while keeping their ventral surfaces close to one another. Although this may appear to be a courtship display, a closer look reveals that the adults are actually defending nesting sites. The nests are about 4 to 5 cm deep, and are dug amongst water grasses, with the eggs attached to the grasses and plant stems.[8]

This formation of mating pairs, nuptial swimming displays, and guarding of the nests shows that red-bellied piranhas exhibit parental care for the nest and the young.[8] When left unattended, other fish, such as characids, may prey upon the eggs. Despite the defensive practice of circling the nests, red-bellied piranhas are often passive towards other fish that approach the nest. It is possible that the mere presence of the piranha, a natural predator, provides enough of a threat to prevent potential predators from approaching the nest.[13]

Piranhas have two annual reproductive seasons; these seasons are tied to water level fluctuations, the flooding pulse, temperature, and other hydrological conditions.[13] When individuals are ready to become sexually active, they will lose their red coloration and select habitats that are conducive to spawning, such as flooded marginal grasses and vegetation within lakes. This habitat selection is a clear distinction from non-reproductive individuals that prefer open water and under floating meadows.[8]

Shoaling[edit]

Red-bellied piranhas often travel in shoals as a predatory defense. In studies that tested the piranhas' reactions to a simulated predator attack, resting opercular rates returned to normal more quickly amongst piranhas that were in shoals of eight rather than in shoals of two. Although it has been presumed that piranhas engage in pack-hunting behavior, no investigation shows that shoaling behavior among piranhas is used for cooperative hunting.[14]

Most likely, this shoaling behavior is a defense against predation from larger animals such as dolphins, large piscivorous fish, caimans, and aquatic birds.[14] Piranhas will travel to their nesting sites in shoals in order to reduce the likelihood that any single individual will be attacked by a predator. Shoals of red-bellied piranha use the margins of flooded areas to build their nests.[15]

Communication and signaling[edit]

Acoustic communication among red-bellied piranhas is exhibited along with aggressive behaviors, such as biting, chasing, conspecific confrontation, and fighting.[9] The sounds created by piranhas are generated through rapid contractions of the sonic muscles and is associated with the swimbladder. The swimbladder may play an important role in sound production as a resonator.[16] all of the observations made on sound production by red-bellied pirhana have been when specimens were held by hand. When taken out of the water, the red-bellied piranha will emit a drumming-like sound, consisting of a low-frequency harmonic sound.[17] However, research has shown the presence of three types of acoustic emissions that are associated with specific behaviors. Type one calls are made up of harmonic sounds, last approximately 140 milliseconds at 120 Hz, and are associated with frontal display behavior between two fish. Type two sounds last approximately 36 milliseconds at 40 Hz, and are associated with circling and fighting behavior related to food competition. Type three sounds are made up of a single pulse lasting just 3 milliseconds at 1740 Hz, and are highly associated with chasing behavior toward a conspecific individual. This same sound is also produced when an individual snaps its jaws to bite another individual.[17]

Nearly all sounds produced by red-bellied piranhas are produced in the context of social interactions between individuals. The low, drumming sounds are typically produced during moderate attacks, while loud, threatened sounds are produced during more vigorous attacks.[17]

Conservation status[edit]

Currently, the red-bellied piranha is not classified as threatened or endangered by the International Union for Conservation of Nature. Though the species is not considered threatened, the collection and trade of the species to aquariums may be causing a low risk to the red-bellied piranha. At this time, there are no specific conservation efforts for the red-bellied piranha.[4]

In the media[edit]

Many myths surround this species. The 1978 film Piranha by Joe Dante shows these fish in a similar light to Jaws. Piranha was followed by a sequel, Piranha II: The Spawning, in 1981, and two remakes, one in 1995, and one in 2010. Films such as these, and stories of large schools of red-bellies attacking humans, fuel their exaggerated and erroneous reputation as being one of the most ferocious freshwater fish. In reality, they are generally timid scavengers, fulfilling a role similar to vultures on land. In the 2010 film Piranha 3D, Christopher Lloyd's character identifies a specimen of the fictional monstrous piranha, specifically as Pygocentrus nattereri, but erroneously refers to them as the first piranhas, when in reality, red-bellied piranha are most likely not the "original" species.[citation needed]

Aquaculture[edit]

Red-bellied piranhas are sometimes kept as aquarium fish. Their natural diet consists of live prey and dead animals and fish. Live feedings to captive piranhas can introduce diseases, and goldfish contain a growth-inhibiting hormone which in turn will affect piranhas. Red-bellied piranhas, particularly when juvenile, will sometimes bite one another in the aquarium, normally on the fins, in behaviour called 'fin nipping'. Fish that have had their fins nipped will grow them back surprisingly rapidly. In order to maintain a piranha aquarium, it is important to keep the water quality up, as they are messy eaters, and this will dirty the water in the tank. They may be fed live, fresh, or frozen food types, but they will not eat rotten meats. Because piranhas in the wild may not eat every day, piranhas in captivity do not need to be fed daily.[18]

References[edit]

  1. ^ "Animal Diversity Web: Pygocentrus nattereri". Animal Diversity Web. University of Michigan. 
  2. ^ Black-finned Pacu Fish, Colossoma macropomum Profile with care, maintenance requirements and breeding information for your tropical fish. Badmanstropicalfish.com. Retrieved on 2012-05-13.
  3. ^ a b Freeman, Barbie; Nico, Leo G.; Osentoski, Matthew; Jelks, Howard L.; Collins, Timothy M. (2007). "Molecular systematics of Serrasalmidae: Deciphering the identities of piranha species and unraveling their evolutionary histories" (PDF). Zootaxa 1484 (4): 1–38. doi:10.1046/j.1439-0469.2000.384132.x. Retrieved 2009-06-22. 
  4. ^ a b c d e "Red-bellied piranha". ARKive. Retrieved 14 November 2013. 
  5. ^ "Pygocentrus nattereri: Red Bellied Piranha". Seriously Fish. Retrieved 21 November 2013. 
  6. ^ Bennett, Wayne A.; Currie, Rebecca J.; Wagner, Paul F.; Beitinger, Thomas L. (September 1997). "Cold Tolerance and Potential Overwintering of the Red-Bellied Piranha in the United States". Transactions of the American Fisheries Society 126 (5): 841–849. doi:10.1577/1548-8659(1997)126<0841:CTAPOO>2.3.CO;2. 
  7. ^ "BBC Nature Red-bellied piranhas". BBC Nature Wildlife. BBC. Retrieved 10 December 2012. 
  8. ^ a b c d Queiroz, Helder Lima; Marcela B. Sobanski; Anne E. Magurran (September 2010). "Reproductive strategies of Red-bellied Piranha (Pygocentrus nattereri Kner, 1858) in the white waters of the Mamirauá flooded forest, central Brazilian Amazon". Environmental Biology of Fishes 89 (1): 11–19. doi:10.1007/s10641-010-9658-1. Retrieved 2 October 2013. 
  9. ^ a b Katenhuber, Edda; Stephan C.F. Neuhauss (20 December 2011). "Acoustic Communication: Sound Advice from Piranhas". Current Biology 21 (24): 986–988. doi:10.1016/j.cub.2011.10.048. Retrieved 3 October 2013. 
  10. ^ a b Putz, Brian. "Pygocentrus nattereri: Redbelly piranha". Retrieved 3 October 2013. 
  11. ^ a b c "Red-bellied piranha". Encyclopedia of Life. Retrieved 3 October 2013. 
  12. ^ Zollinger, Sue Anne. "Piranha - Ferocious Fighter or Scavenging Softie?". Indiana Public Media. 
  13. ^ a b c Uetanabaro, Massao; Tobias Wang; Augusto S. Abe (December 1993). "Breeding behaviour of the red-bellied piranha,Pygocentrus nattereri, in nature". Environmental Biology of Fishes 38 (4): 369–371. doi:10.1007/bf00007529. Retrieved 3 October 2013. 
  14. ^ a b Queiroz, Helder; Magurran, Anne E. (22 June 2005). "Safety in numbers? Shoaling behaviour of the Amazonian red-bellied piranha". Biology Letters 1 (2): 155–157. doi:10.1098/rsbl.2004.0267. PMC 1626212. PMID 17148153. Retrieved 3 October 2013. 
  15. ^ Vicentin, Wagner; dos Santos Costa, Fábio Edir; Súarez, Yzel Rondon (28 April 2012). "Population ecology of Red-bellied Piranha Pygocentrus nattereri Kner, 1858 (Characidae: Serrasalminae) in the Negro River, Pantanal, Brazil". Environmental Biology of Fishes 96 (1): 57–66. doi:10.1007/s10641-012-0022-5. 
  16. ^ Onuki, A; Ohmori Y.; Somiya H. (January 2006). "Spinal Nerve Innervation to the Sonic Muscle and Sonic Motor Nucleus in Red Piranha, Pygocentrus nattereri (Characiformes, Ostariophysi)". Brain, Behavior, and Evolution 67: 11–122. doi:10.1159/000089185. Retrieved 3 October 2013. 
  17. ^ a b c Millot, S.; Vandewalle, P.; Parmentier, E. (12 October 2011). "Sound production in red-bellied piranhas (Pygocentrus nattereri, Kner): an acoustical, behavioural and morphofunctional study". Journal of Experimental Biology 214 (21): 3613–3618. doi:10.1242/jeb.061218. 
  18. ^ Highter, Matthew L. Wittenrich ; with a foreword by Martin A. Moe, Jr. ; principal photographers : Matthew L. Wittenrich, Alf Jacob Nilsen, Scott W. Michael ; illustrations by Joshua (2007). The complete illustrated breeder's guide to marine aquarium fishes. Neptune City, NJ: T.F.H. Publications. ISBN 1890087718. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as SERRASALMUS NATTERERI (red-bellied piranha); referred to as PYGOCENTRUS NATTERERI (red piranha) in 1991 AFS list (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!