Articles on this page are available in 1 other language: Spanish (14) (learn more)

Overview

Brief Summary

Biology

zooxanthellate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Montastraea cavernosa is a reef-building coral of the tropical Atlantic (Nunes et al. 2009). It is abundant in the Caribbean, where it has received considerable attention from coral researchers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology: Skeleton

More info
AuthorSkeleton?Mineral or Organic?MineralPercent Magnesium
Barrios-Su?z et al., 2002 YES MINERAL ARAGONITE
Cairns, Hoeksema, and van der Land, 1999 YES MINERAL ARAGONITE
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Hexacorallians of the World

Source: Hexacorallians of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Aruba, Atlantic, Belize, Bermuda, Bonaire, Brazilian Exclusive Economic Zone, Caribbean Sea, Cayman Islands, Colombia, Costa Rica, Cuba, Curaçao, Guatemala, Gulf of Mexico, Hispaniola, Honduras, Jamaica, Lesser Antilles, Mexico, Nicaragua, Panama, Puerto Rico, Venezuela, West Africa
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda.

In Brazil, reportedly from Cabedelo (06°58'S to 034°50'W) to north of Esprito Santo, and the oceanic Fernando de Noronha Archipelago and Atol das Rocas (Pires et al. 1992, Echeverria et al. 1997).

This species is also known from the eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widespread distribution in the tropical western Atlantic, including the Gulf of Mexico, southern Florida, Bahamas, NW Caribbean, Puerto Rico, lesser Antilles, Central America, Brazil and Bermuda. B71SMI01FCUS: rare in Bermuda, common in Florida, Bahamas, West Indies. B78COL01FCUS: Caribbean, Bahamas, northwestern Gulf of Mexico, and western Africa. A84BRI01FCUS, A83FAR01FCUS, A88TUN01FCUS: Gulf of Mexico. A73GOL00FCUS, A88JAA01FCUS, J89JAA00FCUS, J88WHE00FCUS, B84JAA00FCUS, A77JON01FCUS, A82DAV00FCUS, A87DUS00FCUS, A85DUS01FCUS, A85BUR00FCUS, A81MAR00FCUS: southern Florida. A82CAI01FCUS: Belize. A85REE01FCUS, A88LAN01FCUS: Bahamas. A88FEN00FCUS, A81JOR01FCUS: Mexico. A85HUG01FCUS, A59GOR01FCUS, A67GOR01FCUS, A73WEL01FCUS, A81LID00FCUS, A81LID01FCUS: Jamaica. B82ZLA01FCUS: Cuba. A76LOY01FCUS, A63ALM01FCUS, A70PRE01FCUS: Puerto Rico. A87TOM01FCUS, A85HUB01FCUS, A79DUN01FCUS, A83ROG01FCUS, A76GOO01FCUS, A90EDM00FCUS: lesser Antilles. A74SCA01FCUS, A75BAK01FCUS, A77BAK01FCUS, A78FOC01FCUS: Curacao and Bonaire. B86STE01FCUS, A85FIR01FCUS, A74SCO01FCUS, A82DDO01FCUS, A78DRY01FCUS: Bermuda. A84LAS02FCUS: Panama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Montastraea cavernosa is an abundant reef builder in the Caribbean, being found throughout the region, from Panama to Florida, east to the islands of the Lesser Antilles, and as far north as Bermuda in the north Atlantic. This species is also widespread in the South Atlantic, being common along the coast of Brazil from Cabedelo, Paraiba to Vitoria, Espırito Santo. Montastraea cavernosa has also been reported from the offshore island of Fernando de Noronha, as well as Parcel Manuel Luiz, an offshore reef located 500 km east of the Amazon outflow. Although this species was previously unknown off the north coast of Brazil, Nunes et al. discovered abundant colonies on the offshore reef of Pedra da Risca do Meio at depths of about 25 m. Montastraea cavernosa is also one of the most common coral species in the islands of Sao Tome, Prıncipe and Annobon in the Gulf of Guinea, West Africa, but it has not been reported along the West African mainland nor in the Cape Verde islands farther north. (Nunes et al. 2009 and references therein)
.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is widely distributed through most reef environments from 0.5-95 m depth (Goreau and Wells 1967), with peak abundance from 10-30 m depth (Szmant et al. 1997). Colonies have been observed to 113 m depth (Reed 1985). Although this coral has a high tolerance for turbid and silty environments, this species is not adapted to eutrophic conditions (Tomascik and Sander 1987).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5056 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3851 samples.

Environmental ranges
  Depth range (m): -0.5 - 180
  Temperature range (°C): 18.530 - 28.067
  Nitrate (umol/L): 0.024 - 8.028
  Salinity (PPS): 35.075 - 37.286
  Oxygen (ml/l): 3.986 - 4.854
  Phosphate (umol/l): 0.020 - 0.379
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): -0.5 - 180

Temperature range (°C): 18.530 - 28.067

Nitrate (umol/L): 0.024 - 8.028

Salinity (PPS): 35.075 - 37.286

Oxygen (ml/l): 3.986 - 4.854

Phosphate (umol/l): 0.020 - 0.379

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Overall depth range cited from 0.5-113 m, but typically occurs from 10-60 m on most classes of marine hardbottom communities.

A67GOR01FCUS: 0.5 to 95 m, typically 10 to 60 m depth. A73GOL00FCUS: patch reefs (9 m), outer reef platform (16-20 m), reef slope (20-30 m) and fore reef (30+ m). B86STE01FCUS: 3 to 30 m, open clear waters, inner and outer reefs. A82CAI01FCUS: spur and groove zone, fore reef, 16 to 26+ m. J88WHE00FCUS, A85WHI01FCUS: spur and groove, fore reef. B84JAA00FCUS: low-relief hardbottom and bank reefs. A87TOM01FCUS: reef flat and spur and groove. A76LOY01FCUS: reef flat and fore reef. A85FRI01FCUS: 1-78 m. A74SCO01FCUS: patch reefs. A85REE01FCUS: lowest reported depth (113 m) at San Salvador Island, Bahamas. A89DAH00FCUS: fore reef (10-15 m).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

SEDENTARY

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Colonies of the Caribbean coral Montastraea cavernosa that harbor endosymbiotic cyanobacteria can fix nitrogen, whereas conspecifics without these symbionts cannot. Zooxanthellae (the coral's symbiotic photosynthetic dinoflagellate algae partners) appear to be somehow able to use these supplementary sources of nitrogen and increase their growth rates without compromising the integrity of the symbiosis (Lesser et al. 2007). Nitrogen limitation has long been proposed to contribute to the stability of the coral-zooxanthellae symbiosis. How this symbiosis is maintained despite nitrogen supplementation from nitrogen-fixing cyanobacteria is an open question.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Information is needed on the number of occurrences in the tropical western Atlantic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Occurs on most classes of marine hardbottom communities, including low-relief hardbottom areas, patch reefs, fringing reefs, spur and groove reefs, transitional reefs, intermediate reefs and deeper reef slopes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

A84PET01FCUS, A81ANT02FCUS: black band disease, protozoan parasites. A84LAS02FCUS, A90GHI01FCUS, A90WIL01FCUS: susceptible to bleaching (loss of zooxanthellae) due to adverse environmental conditions. A80LAS01FCUS: efficient sediment rejector and more aggressive than congener (see A76LOY01FCUS, A81MAR00FCUS, A79ROG01FCUS). A92COL01FCUS: salinity tolerance to 48 ppt. A15VAU01FCUS: growth rate measured at 4.83-14.5 mm/yr increase in diameter and 3.22-5.67 mm/yr increase in height (see also A85HUB01FCUS).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

In contrast to most coral species in the family Faviidae, colonies of Montastraea cavernosa are generally either all-male or all-female. They are broadcast spawners. In a study on the Caribbean coast of Colombia (October 1990 to October 1991), Acosta and Zea (1997) found that there was a single gametogenic (egg- and sperm-producing) cycle per year in both sexes. The duration of the oogenic cycle was ~11 months, with oogenesis (egg production) in all months except just after spawning (Szmant 1991). Of the colonies with gonads sampled in November 1990, all female eggs were already in Stage I. Development of eggs to Stage II (yolk comprising up to 50% of the cytoplasm) was evident in late December 1990 to early January 1991, and development of Stage III eggs began in March 1991. A marked increase in the mean gonad index did not occur until after July 1991. In contrast to the female cycle, the spermatogenic cycle lasted only 2 to 4 months. Male gonads, were first evident in October and November 1990, disappeared until the full moon of June, when testes with most spermatic cysts in Stage I were observed. Stages II and III cysts were evident from the beginning of the cycle, but the latter constituted a large percent of the sex products only after August 1991. The mean gonad index increased from June through October. By and after the full moon of October 1990 and 1991, most cysts of male colonies were in Stage III. Spawning did not occur synchronously within the population, since maturing, fully mature and spawned colonies were found simultaneously on several sampling dates. (Acosta and Zea 1997 and references therein). Zooxanthellae are not present in the eggs and must be acquired from the water column de novo during the planktonic larval phase or after settlement (Szmant 1991). Broadcast spawning is now recognized as typical for reef-building corals, but for years brooding with multiple planulation cycles (production within, and release from, coral polyps) of planula larvae per year was thought to be the norm for reef corals (Szmamt 1991).

In a study of seven "massive" Caribbean corals, Soong (1993) identified major differences in reproductive behavior between species with large maximum colony size (>100 cm2 in surface area), including Montastraea cavernosa, and species with small maximum colony size. The four large species studied broadcast gametes during a short spawning season; the two smaller-sized and one medium-sized species brooded larvae during an extended season (year-round in Panama).

Prior to the early 1980s, for over 200 years, all corals were believed to be viviparous (brooding). It is now known that most reef-building corals release, or "broadcast", eggs and sperm into the water column during periodic and often synchronous spawning events. For decades researchers have speculated about and worked to identify environmental entrainment factors that might influence sexual reproduction and the eventual release of gametes. This synchronization is generally believed to operate on at least three interrelated temporal levels: (1) the time of the year; (2) the lunar cycle; and (3) the time of night. It is clear that nighttime is required for gamete release, but a consistent global relationship between lunar phase and the timing of spawning is less clear, given that most corals on the Great Barrier Reef in Australia spawn at neap tides, while the same species in southern Japan spawn at spring tides. It has seemed reasonable to assume that the time of the year for gamete release is linked to optimal sea surface temperature (SST). van Woesik et al. (2006), however, have argued that solar insolation (energy from the sun), is a better predictor of gamete production for many corals.They tested this hypothesis using data for 12 species of corals distributed throughout the Caribbean (tropical west Atlantic), including Montastraea cavernosa. Regarding temperature, they found that the cumulative dose of SST measured through time and the rate of change in temperature correlated poorly with the timing of coral spawning, although the average temperature during the month of spawning was significantly correlated with spawning. For solar insolation, they found that the rate of change and the cumulative response of solar insolation cycles was a better predictor of gamete release, although solar insolation intensity at the time of spawning was not. All of the coral species they examined showed highly significant positive relationships between spawning date and the cumulative dose of solar insolation, and 11 of 12 species, including Montastraea cavernosa, showed a significant response to the rate of change in solar insolation. Solar insolation and temperature are obviously related phenomena since solar irradiance ultimately drives SST, but because of the high specific heat capacity of water, maximum SST generally lags 1 to 2 months (or more) behind maximum solar insolation. Time delays in SST fluctuations are latitudinally predictable but vary with cloud-cover and windstrength. van Woesik et al. concluded that solar insolation influences the reproductive schedules of Caribbean corals, but water temperatures must be optimal (28–30 C) to allow maturation and gamete release. (van Woesik et al. 2006 and referencess therein)

Vize (2006) asserts that for shallow water corals, annual water temperature cycles set the month, lunar periodicity the day, and sunset time the hour of spawning. This tight temporal regulation is critical for achieving high fertilization rates in a pelagic environment. Given the differences in light and temperature that occur with depth and the importance of these parameters in regulating spawn timing, it it had been unclear whether corals in deeper water can respond to the same environmental cues that regulate spawning behaviour in shallower coral. Vize used a remotely operated vehicle to monitor coral spawning (including that of Montastraea cavernosa) activity at the Flower Garden Banks (northwest Gulf of Mexico) at depths from 33 to 45 meters. All recorded spawning events were within the same temporal windows as shallower conspecifics. These data indicate that deep corals at this location either sense the same environmental parameters, despite local attenuation, or communicate with shallower colonies that can sense such spawning cues.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A86SZM00FCUS, A91SZM01FCUS: gonochoric protogynous with broadcast spawning. Gemetogenesis for female colonies during late July and for male colonies from mid-May to June. Spawning takes place during late August and is the only favid known to be gonochoric.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Phylogeography

Nunes et al. (2009) compared the levels of genetic diversity and connectivity in the coral Montastraea cavernosa among both central and peripheral populations throughout its range in the Atlantic. Genetic data from one mitochondrial and two nuclear loci in 191 individuals show that M. cavernosa is subdivided into three genetically distinct regions in the Atlantic: Caribbean-North Atlantic, Western South Atlantic (Brazil) and Eastern Tropical Atlantic (West Africa). Within each region, populations have similar allele frequencies and levels of genetic diversity. No significant differentiation was found between populations separated by as much as 3000 km, suggesting that this coral species has the ability to disperse over large distances. Gene flow within regions does not, however, translate into connectivity across the entire Atlantic. Instead, substantial differences in allele frequencies across regions suggest that genetic exchange is infrequent between the Caribbean, Brazil, and West Africa. Furthermore, markedly lower levels of genetic diversity are observed in the Brazilian and West African populations. Genetic diversity and connectivity may contribute to the resilience of a coral population to disturbance. Isolated peripheral populations may be more vulnerable to human impacts, disease, or climate change relative to those in the genetically diverse Caribbean-North Atlantic region. Although limited dispersal and connectivity in marine organisms can have negative fitness effects in populations that are small and isolated, reduced genetic exchange may also promote the potential for local adaptation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Kelmanson and Matz (2003) studied the molecular basis of color diversity in Montastraea cavernosa. Typically, each natural pigment in corals and other anthozoans is essentially determined by a sequence of a single protein, homologous to the green fluorescent protein (GFP) fromthe jellyfish Aequorea victoria. [The discovery of GFP in A. victoria in 1962, and its subsequent development as a powerful tool in molecular biology, were the the basis for the 2008 Nobel Prize in Chemistry.] Kelmanson and Matz studied three colonies of Montastraea cavernosa representing distinct color morphs. Unexpectedly, these specimens were found to express the same collection of GFP-like proteins, produced by at least four, and possibly up to seven, different genetic loci. These genes code for three basic colors—cyan, green, and red—and are expressed differently relative to one another in different morphs.

As Kelmanson and Matz note, two basic alternative mechanisms of generating diversity of coloration are possible in principle: genetic polymorphism and polyphenism. Genetic polymorphism is the circumstance in which differences (such as color) can be traced to differences in the genome (i.e., different morphs have different DNA sequences coding for the trait in question). If the Montastraea cavernosa color variation is the result of a simple genetic polymorphism, then the color should be largely determined at the moment of zygote formation (fertilization of an egg), with little possibility for it to change afterwards, except for the intensity. In contrast, "polyphenism" refers to the ability of a single genotype to produce two or more alternative morphologies within a single population in response to an environmental cue. In the case of Montastraea cavernosa, the observed color variation would be an example of polyphenism if the same set of genes coding for GFP-like proteins are present in two or more color morphs, with the differences in color appearance being due to the changes in relative levels of expression of these genes. (The color diversity could also result from a combination of these two models.) In Montastraea cavernosa, the color differences between colonies can be explained by varying levels of expression (specifically, transcript abundances) of a set of genes coding for GFP-like proteins. The set includes at least four, and probably up to seven, separate genetic loci and encodes proteins emitting at three general wavebands: cyan (wide emission peak at around 495 nm), green (narrow emission peak at 505 to 520 nm), and red (emission at 580 nm). Kelmanson and Matz found that two different color morphs of Montastraea cavernosa, green and red, contained and expressed the same functional suite of color genes. No environmental cues are yet known that would confirm this color variation as environmentally-based polyphenism, but the authors suggest that depth could be one factor affecting color expression (Kelmanson and Matz 2003).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Montastraea cavernosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAGTTTTTGGTGTTGGAGCAGGTCTAATTGGGACTGCTTTTAGTATGCTTATACGATTGGAACTTTCTGCGCCAGGCGCTATGTTAGGTGAT---GATCATCTTTATAATGTAATTGTAACAGCACATGCTTTTATTATGATTTTTTTTTTAGTAATGCCGGTTATGATTGGGGGATTTGGAAACTGGTTAGTGCCATTATATATTGGGGCACCGGATATGGCGTTCCCCCGATTAAATAATATTAGTTTTTGGTTATTACCACCTGCTTTGCTTTTATTGTTAGGCTCTGCTTTTGTTGAACAAGGCGCAGGAACGGGATGAACGGTTTATCCTCCTCTTTCTGATATCTATGCGCACTCTGGGGGTTCTGTTGACATGGTTATTTTTAGTCTTCATTTAGCTGGGGTTTCTTCTATCTTAGGAGCAATAAACTTTATTACAACGATTTTCAACATGCGAGCCCCTGGTGTTTCTTTTAATAGAATGCCTTTGTTTGTTTGGTCTATTTTAATAACTGCTTTTTTATTACTTTTATCTTTGCCTGTATTAGCGGGTGCAATTACTATGTTATTAACAGATCGAAATTTTAATACAACTTTTTTTGATCCTTCTGGAGGCGGAGATCCTATTTTATTTCAACATTTATTTTGGTTTTTTGGGCATCCTGAGGTTTATATTTTAATTTTGCCTGGTTTTGGTATGATTTCTCAAATAATCCCGACTTTTGTTGCTAAAAAACAAATTTTTGGGTATTTAGGGATGGTTTATGCGATGCTTTCAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Montastraea cavernosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Australian Museum, Sydney
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Aronson, R., Bruckner, A., Moore, J., Precht, B. & E. Weil

Reviewer/s
Livingstone, S., Polidoro, B. & Smith, J. (Global Marine Species Assessment)

Contributor/s

Justification
The most important known threat for this species is extensive reduction of coral reef habitat due to a combination of threats. Specific population trends are unknown but population reduction can be inferred from estimated habitat loss (Wilkinson 2004). It is not widespread and is common throughout its range and therefore is likely to be more resilient to habitat loss and reef degradation because of an assumed large effective population size that is highly connected and/or stable with enhanced genetic variability. Therefore, the estimated habitat loss of 10% from reefs already destroyed within its range is the best inference of population reduction since it may survive in coral reefs already at the critical stage of degradation (Wilkinson 2004). This inference of population reduction over three generation lengths (30 years) does not meet the threshold of a threat category and this species is Least Concern. However, because of predicted threats from climate change and ocean acidification it will be important to reassess this species in 10 years or sooner, particularly if the species is also observed to disappear from reefs currently at the critical stage of reef degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread distribution in the tropical western Atlantic and occurs in abundance on most classes of marine hardbottom communities. Characterized by very high resistance to sedimentation but incidence of disease and bleaching reported.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common and tends to be the more abundant of the Montastraea species in environments with moderate sedimentation.

There is no species specific population information available for this species. However, there is evidence that overall coral reef habitat has declined, and this is used as a proxy for population decline for this species. This species is more resilient to some of the threats faced by corals and therefore population decline is estimated using the percentage of destroyed reefs only (Wilkinson 2004). We assume that most, if not all, mature individuals will be removed from a destroyed reef and that on average, the number of individuals on reefs are equal across its range and proportional to the percentage of destroyed reefs. Reef losses throughout the species' range have been estimated over three generations, two in the past and one projected into the future.

The age of first maturity of most reef building corals is typically three to eight years (Wallace 1999) and therefore we assume that average age of mature individuals is greater than eight years. Furthermore, based on average sizes and growth rates, we assume that average generation length is 10 years, unless otherwise stated. Total longevity is not known, but likely to be more than ten years. Therefore any population decline rates for the Red List assessment are measured over at least 30 years. Follow the link below for further details on population decline and generation length estimates.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Data from southern Florida indicates stability but information needed on the trend of extant populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The major threats to this species are disease (black band disease and white plague) and bleaching, although the proportion of colonies affected is generally lower than that observed in the other Montastraea species (Bruckner and Bruckner 1997). Localized threats include bioerosion by sponges and other organisms, other diseases, hurricane damage, and high sedimentation.

In general, the major threat to corals is global climate change, in particular, temperature extremes leading to bleaching and increased susceptibility to disease, increased severity of ENSO events and storms, and ocean acidification.

Coral disease has emerged as a serious threat to coral reefs worldwide and a major cause of reef deterioration (Weil et al. 2006). The numbers of diseases and coral species affected, as well as the distribution of diseases have all increased dramatically within the last decade (Porter et al. 2001, Green and Bruckner 2000, Sutherland et al. 2004, Weil 2004). Coral disease epizootics have resulted in significant losses of coral cover and were implicated in the dramatic decline of acroporids in the Florida Keys (Aronson and Precht 2001, Porter et al. 2001, Patterson et al. 2002). In the Indo-Pacific, disease is also on the rise with disease outbreaks recently reported from the Great Barrier Reef (Willis et al. 2004), Marshall Islands (Jacobson 2006) and the northwestern Hawaiian Islands (Aeby 2006). Increased coral disease levels on the GBR were correlated with increased ocean temperatures (Willis et al. 2007) supporting the prediction that disease levels will be increasing with higher sea surface temperatures. Escalating anthropogenic stressors combined with the threats associated with global climate change of increases in coral disease, frequency and duration of coral bleaching and ocean acidification place coral reefs in the Indo-Pacific at high risk of collapse.

Localized threats to corals include fisheries, human development (industry, settlement, tourism, and transportation), changes in native species dynamics (competitors, predators, pathogens and parasites), invasive species (competitors, predators, pathogens and parasites), dynamite fishing, chemical fishing, pollution from agriculture and industry, domestic pollution, sedimentation, and human recreation and tourism activities.

The severity of these combined threats to the global population of each individual species is not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: Not considered threatened due to a high tolerance to sedimentation but incidence of disease and bleaching well documented.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the US, it is present in many MPAs, including Florida Keys National Marine Sanctuary, Biscayne N.P., Dry Tortugas National Park, Buck Island Reef National Monument and Flower Garden Banks National Marine Sanctuary. Also present in Hol Chan Marine Reserve (Belize), Exuma Cays Land and Sea Park (Bahamas). In US waters, it is illegal to harvest corals for commercial purposes. There is a need for more quantitative information on the status of the populations in deeper habitats.

All corals are listed on CITES Appendix II.

Recommended measures for conserving this species include research in taxonomy, population, abundance and trends, ecology and habitat status, threats and resilience to threats, restoration action; identification, establishment and management of new protected areas; expansion of protected areas; recovery management; and disease, pathogen and parasite management. Artificial propagation and techniques such as cryo-preservation of gametes may become important for conserving coral biodiversity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Data is needed on recruitment patterns and susceptibility to eutrophication.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Numerous occurrences in the Florida Keys National Marine Sanctuary, Biscayne National Park and Dry Tortugas, Florida.

Needs: Mooring buoys need to be installed in marine protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great star coral

The Great star coral (Montastraea cavernosa) is a colonial stony coral found in the Caribbean seas. It forms into massive boulders and sometimes develops into plates. Its polyps are the size of a human thumb and fully extend at night.[1] Great star coral colonies form massive boulders and domes over 5 feet (1.5 m) in diameter in waters of shallow and moderate depths. In deeper waters, this coral has been observed growing as a plate formation. It is found throughout most reef environments, and is the predominant coral at depths of 40–100 feet (12.2-30.5 m).

This coral occasionally has a fluorescent red or orange color during daytime; it has recently been suggested that this color is due to phycoerythrin, a cyanobacterial protein. It appears that, in addition to symbiotic zooxanthella, this coral harbors endocellular symbiotic cyanobacteria, possibly to help it fix nitrogen. However more recently, Oswold et al. (2007) showed an absence of functional phycoerythrin in M. Cavernosa.[2]

A related species is M. annularis, which has smaller polyps.

References[edit]

  1. ^ "Common Corals of Florida". Retrieved 2008-05-29. 
  2. ^ Contributions of host and symbiont pigments to the coloration of reef corals, Franz Oswald, Florian Schmitt, Alexandra Leutenegger, Sergey Ivanchenko, Cecilia D'Angelo, Anya Salih, Svetlana Maslakova, Maria Bulina, Reinhold Schirmbeck, G. U. Nienhaus, Mikhail V. Matz, Jörg Wiedenmann, FEBS Journal, Volume 274, Issue 4, pages 1102–1122, February 2007
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Lasker (1980) recognized two morphotypes: (1) a diurnal morph with smaller polyps and (2) a nocturnal morph with larger polyps.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!